?2772224 Summary - Canadian Patents Database (2025)

DEMANDES OU BREVETS VOLUMINEUX
LA PRESENTE PARTIE DE CETTE DEMANDE OU CE BREVETS
= COMPREND PLUS D'UN TOME.
CECI EST LE TOME 1 _________________________ DE 2
NOTE: Pour les tomes additionels, veillez contacter le Bureau Canadien des
Brevets.
JUMBO APPLICATIONS / PATENTS
THIS SECTION OF THE APPLICATION / PATENT CONTAINS MORE
THAN ONE VOLUME.
THIS IS VOLUME 1 OF 2
NOTE: For additional volumes please contact the Canadian Patent Office.

= CA 2772224 2017-03-13
1 = =
COMPLETE GENOME SEQUENCE OF THE METHANOGEN
METHANOBREVIBACTER RUMINANTIUM
RELATED APPLICATIONS
This application claims the benefit of United States . Provisional Patent
Application
=61/237,296 filed August 27, 2009 and New Zealand Provisional Patent
Application
579292 filed August 27, 2009.
FIELD OF THE INVENTION
The present invention encompasses the complete genome sequence for the
methanogen, Mettranobrevibacter ruminantium. The invention encompasses
polynucleotides which encode M. ruminantium polypeptides or peptides, as well
as
polynucleotides from non-coding and intergenic regions. Also encompassed are
the
encoded M. ruminantium polypeptides and peptides, and antibodies directed to
these
peptides or polypeptides. The invention also encompasses expression vectors
and host
cells for producing these peptides, polypeptides, polynudeotides, and
antibodies. The
invention further encompasses methods and compositions for detecting,
targeting, and
inhibiting microbial cells, especially methanogen cells such as M. ruminantium
cells,
using one or more of the disclosed peptides, polypeptides, polynucleotides,
antibodies,
= - 20 expression vectors, and host cells.
BACKGROUND OF THE INVENTION
Global surface temperatures are predicted to increase between 1.1 C to 6.4 C
during
the twenty-first century primarily due to increased levels of greenhouse
gases.(GHGs)
in the atmosphere (Solomon et al., 2007). Methane (CH4) is a particularly
potent GHG,
having a global warming potential 21 times that of carbon dioxide (CO2) (IPCC,
2007)
and accounts for 16% of total global GHG emissions (Scheehle & Kruger, 2006).
Methane from agriculture represents around 40% of the emissions produced by
human-
related activities; the single largest source of which is from enteric
fermentation in
livestock, mainly from ruminant animals (Steinfeld et al., 2006). The
worldwide demand
for meat and milk is predicted to double by 2050 (Food and Agriculture
Organization of
the United Nations (FAO), 2008) and ruminant-based agricultural activities are
expected
to continue to be an important contributor to global CH4 emissions. Therefore,
reducing
CH4 emissions from ruminants will be important in meeting international
commitments

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
2 .
under the Kyoto Protocol and also in ensuring the long-term sustainability of
ruminant-
based agriculture. Moreover, as CH4 production in the rumen accounts for 2-12%
of the
ingested energy (Johnson & Johnson, 1995), it is predicted that reducing CH4
emissions from ruminants will also make more energy available to the animal
and
therefore enhance their productivity. Ruminant animals are particularly
important to
agriculture in New Zealand (NZ), producing a third of NZ's commodity exports
(Statistics
New Zealand, 2008) and making up a large proportion of the internationally
traded lamb
and milk products (Leslie et al., 2008). Consequently, NZ has an unusual GHG
emission profile, with ruminant CH4 emissions accounting for 31% of NZ's total
GHG
emissions (Ministry for the Environment, 2007).
Methane is formed in the fore-stomach (reticulorumen, or more commonly known
as the
rumen) by methanogens, a subgroup of the Archaea. During normal rumen
function,
plant material is broken down by fibre-degrading microorganisms and fermented
mainly
to volatile fatty acids (VFAs), ammonia, hydrogen (H2) and CO2. Rumen
methanogens
principally use H2 to reduce CO2 to CH4 in a series of reactions that are
coupled to ATP
synthesis. The rumen harbours a variety of different methanogen species, but
analyses
of archaeal small subunit ribosomal RNA genes from rumen samples of ruminants
on
differing diets around the world suggest the majority fall into three main
groups:
Methanobrevibacter, Methanomicrobium and a large, as yet uncultured, group of
rumen
archaea referred to as rumen cluster C (Janssen & Kirs, 2008). Sequences
affiliated
with Methanobrevibacter dominate, on average accounting for 61.6% of rumen
archaea,
with sequences associated with M. gottschalkii (33.6%) and M. ruminant/urn
(27.3%)
being most prominent.
Attempts have been made to inhibit the action of methanogens in the rumen
using a
variety of interventions but most have failed, or met with only limited
success, due to
low efficacy, poor selectivity, toxicity of compounds against the host, or
build up of
resistance to anti-methanogen compounds (McAllister & Newbold, 2008).
Currently
there are few practical methane reduction technologies available for housed
ruminant
animals, and no effective technologies for grazing animals. Methane
interventions
should ideally target features that are conserved across all rumen
methanogens, so that
no unaffected methanogens can fill the vacated niche. Interventions should
also be
specific for methanogens only, such that other rumen microbes continue their
normal
.. digestive functions. Whole genome sequencing allows the definition of gene
targets that

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
3
are both conserved and specific to rumen methanogens. It is not yet possible
to obtain
genome sequences of all methanogen groups present in the rumen as some are yet
to
be cultivated, and a rumen methanogen "metagenome" is prevented by the
inability of
current sequencing technologies to reassemble complete genomes from complex
microbial ecosystems. Therefore, sequencing the genomes of individual rumen
methanogens currently in culture is a critical step in developing CH4
mitigation
technologies for ruminant animals.
SUMMARY OF THE INVENTION
Here we report the genome sequence of M. ruminantium M1T (DSM 1093), the first
rumen methanogen genome to be completely sequenced. We have included a
particular emphasis on identifying targets for enteric methane mitigation
technologies
focusing on vaccine development and anti-methanogen drug leads.
The invention thus features the complete genome sequence for the methanogen,
Methanobrevibacter ruminantium. The invention features, in particular,
isolated
peptides, polypeptides, and polynucleotides of M. ruminantium, as well as
expression
vectors, host cells, and antibodies, and methods of use thereof, as described
in detail
herein.
The invention specifically features an isolated peptide comprising, for
example, at least
a fragment of one amino acid sequence selected from the group consisting of
SEQ ID
NO: 5867-7584. In a particular aspect, the peptide comprises at least a
fragment of an
amino acid sequence of any one of SEQ ID NO: 5867-7584. In a further aspect,
the
peptide comprises at least a fragment of an amino acid sequence of any one of
SEQ ID
NO: 5867-7584. In another aspect, the peptide is a fragment, for example,
comprising
at least one amino acid sequence encompassing an extracellular domain of any
one of
SEQ ID NO: 5867-7584.
The invention specifically features an isolated polypeptide comprising, for
example, at
= 30 least one amino acid sequence selected from the group consisting of
SEQ ID NO:
5867-7584. In a particular aspect, the polypeptide comprises the amino acid
sequence
of any one of SEQ ID NO: 5867-7584. In a further aspect, the polypeptide
comprises
the amino acid sequence of any one of SEQ ID NO: 5867-7584. In another aspect,
the

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
4
polypeptide is a fragment, for example, comprising at least one amino acid
sequence
encompassing an extracellular domain of any one of SEQ ID NO: 5867-7584.
The invention additionally features an isolated polynucleotide comprising a
coding
sequence for at least one peptide. In one aspect, the polynucleotide comprises
a coding
sequence for at least a fragment of an amino acid sequence selected from the
group
consisting of SEQ ID NO: 5867-7584. In a particular aspect, the polynucleotide
comprises a coding sequence for at least a fragment of any one of SEQ ID NO:
5867-
7584. In a further aspect, the polynucleotide comprises a coding sequence for
at least a
fragment of any one of SEQ ID NO: 5867-7584. In another aspect, the
polynucleotide
comprises a fragment of a coding sequence, for example, least one amino acid
sequence encompassing an extracellular domain of any one of SEQ ID NO: 5867-
7584.
The invention additionally features an isolated polynucleotide comprising a
coding
sequence for at least one polypeptide. In one aspect, the polynucleotide
comprises a
coding sequence for at least one amino acid sequence selected from the group
consisting of SEQ ID NO: 5867-7584. In a particular aspect, the polynucleotide
comprises a coding sequence for any one of SEQ ID NO: 5867-7584. In a further
aspect, the polynucleotide comprises a coding sequence for any one of SEQ ID
NO:
5867-7584. In another aspect, the polynucleotide comprises a fragment of a
coding
sequence, for example, least one amino acid sequence encompassing an
extracellular
domain of any one of SEQ ID NO: 5867-7584.
In an additional aspect, the invention features an isolated polynucleotide
comprising, for
example, a nucleic acid sequence selected from the group consisting of SEQ ID
NO: 1-
1718. In a particular aspect, the polynucleotide comprises the nucleic acid
sequence of
SEQ ID NO: 1-1718. In another aspect, the polynucleotide is a fragment or an
oligonucleotide comprising, for example, the nucleic acid sequence
encompassing an
extracellular domain as encoded by any one of SEQ ID NO: 1-1718. In addition,
the
invention encompasses an isolated polynucleotide, or fragment thereof, which
hybridizes to any one of the nucleic acid sequences of SEQ ID NO: 1-1718. The
invention further encompasses an isolated polynucleotide comprising the
complement,
reverse complement, reverse sequence, or fragments thereof, of any one of the
nucleic
acid sequences.

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
The invention features an expression vector comprising a polynucleotide of the
invention. In one aspect, the expression vector comprises a coding sequence
for at
least a fragment of an amino acid sequence selected from the group consisting
of SEQ
ID NO: 5867-7584. In a particular aspect, the expression vector comprises a
coding
5 sequence for at least a fragment of at least one of SEQ ID NO: 5867-7584.
In a further
aspect, the expression vector comprises a coding sequence for at least one
amino acid
sequence of at least one of SEQ ID NO: 5867-7584. In another aspect, the
expression
vector comprises a coding sequence for at least one amino acid sequence
encompassing an extracellular domain of any one of SEQ ID NO: 5867-7584.
The invention also features a host cell, for example, a microbial host cell,
comprising at
least one expression vector.
The invention specifically features an antibody directed to a peptide,
polypeptide, or
polynucleotide as disclosed herein. In certain aspects, the antibody is
directed to an
amino acid sequence selected from the group consisting of SEQ ID NO: 5867-
7584. In
alternate aspects, the antibody is directed to at least a fragment of a
polypeptide
sequence selected from the group consisting of SEQ ID NO: 5867-7584. In a
particular
aspect, the antibody binds to at least a fragment of the peptide sequence of
any one of
SEQ ID NO: 5867-7584. In a further aspect, the antibody binds to at least a
fragment of
the polypeptide sequence of any one of SEQ ID NO: 5867-7584. In an alternate
aspect,
the antibody binds to at least a fragment of a peptide or polypeptide
encompassing an
extracellular domain of any one of SEQ ID NO: 5867-7584. In another aspect,
the
antibody includes one or more fusions or conjugates with at least one cell
inhibitor, for
example, anti-methanogenesis compounds (e.g., bromoethanesulphonic acid),
antibodies and antibody fragments,, lytic enzymes, peptide nucleic acids,
antimicrobial
peptides, and other antibiotics as described in detail herein.
The invention additionally features modified peptides or polypeptides, e.g.,
for at least
one of SEQ ID NO: 5867-7584, including biologically active alterations,
fragments,
variants, and derivatives, described herein. Also featured are polynucleotides
encoding
these modified peptides or polypeptides, as well as alterations, fragments,
variants, and
derivatives of the disclosed polynucleotides; antibodies raised using these
modified
peptides, polypeptides, or polynucleotides; expression vectors comprising
these
polynucleotides; and host cells comprising these vectors. Further featured are
modified

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
6
antibodies, including biologically active alterations, fragments, variants,
and derivatives,
described herein. In specific aspects, the compositions and methods of the
invention
employ these modified peptides, polypeptides, polynucleotides, antibodies, or
corresponding expression vectors or host cells.
The invention features a composition comprising an isolated peptide or
polypeptide,
e.g., at least one of SEQ ID NO: 5867-7584. Also featured is a composition
comprising
an isolated polynucleotide, e.g., at least one of SEQ ID NO: 1-1718. The
invention
additionally features a composition comprising an antibody, e.g., directed to
a peptide,
polypeptide, or polynucleotide sequence disclosed herein. Further featured is
a
composition that includes an expression vector, or host cell comprising an
expression
vector, in accordance with the invention. The composition can include any one
of the
biologically active alterations, fragments, variants, and derivatives
described herein.
The compositions can include at least one cell inhibitor (e.g., as a fusion or
conjugate),
and can be formulated, for example, as pharmaceutical compositions, in
particular,
vaccine compositions.
The invention also features a composition of the invention as part of a kit
for targeting
and/or inhibiting microbial cells, especially methanogen cells, in accordance
with the
disclosed methods. The kits comprise: a) at least one composition as set out
herein;
and b) optionally, instructions for use, for example, in targeting cells or
inhibiting cell
growth or replication for methanogens or other microbes.
The invention also features a method for producing a peptide or polypeptide,
e.g., at
least a fragment of any one of SEQ ID NO: 5867-7584, the method comprising: a)
culturing an expression vector or host cell comprising an expression vector,
which
comprises at least part of a coding sequence for at. least one peptide or
polypeptide
under conditions suitable for the expression of the peptide or polypeptide;
and b)
recovering the peptide or polypeptide from the culture. In particular aspects,
the peptide
or polypeptide comprises at least one amino acid sequence selected from the
group
consisting of SEQ ID NO: 5867-7584, or modified sequences thereof.
The invention also features a method for producing an antibody, e.g., directed
to at
least a fragment of any one of SEQ ID NO: 5867-7584, the method comprising: a)
culturing an expression vector or host cell comprising an expression vector,
which

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
7
comprises at least part of a coding sequence for at least one antibody or
antibody
fragment under conditions suitable for the expression of the antibody or
antibody
fragment; and b) recovering the amino acid sequence from the culture. In
particular
aspects, the antibody or antibody fragment is directed to at least one amino
acid
sequence selected from the group consisting of SEQ ID NO: 5867-7584, or
modified
sequences thereof. In an alternate aspect, the antibody is produced by
administration to
a host animal, as described in detail herein.
The invention additionally features a method for producing an antibody, e.g.,
directed to
at least a fragment of any one of SEQ ID NO: 5867-7584, which comprises a
fusion or
conjugate with at least one cell inhibitor. Such method comprises: a)
culturing an
expression vector or host cell comprising an expression vector, which
comprises a
coding sequence for at least one antibody or antibody fragment under
conditions
suitable for the expression of the antibody or antibody fragment; b) forming a
fusion or
conjugate to the antibody or antibody fragment (e.g., by expression of the
fused
sequence or chemical conjugation to the cell inhibitor); and c) recovering the
fusion or
conjugate.
In particular aspects, the antibody is directed to at least a fragment of any
one of SEQ
ID NO: 5867-7584, or modified sequences thereof. In further aspects, the
inhibitor is
selected from anti-methanogenesis compounds (e.g., bromoethanesulphonic acid),
antibodies and antibody fragments, lytic enzymes, peptide nucleic acids,
antimicrobial
peptides, and other antibiotics as described in detail herein. In an alternate
aspect, the
antibody is produced by administration to a host animal and then conjugated,
as
described in detail herein.
In addition, the invention features a method of inhibiting (e.g., inhibiting
growth or
replication) of a microbial cell, in particular, a methanogen cell,
comprising: contacting
= the cell with antibody or antibody fragment, e.g., directed to at least a
fragment of any
one of SEQ ID NO: 5867-7584, or an antibody fusion or conjugate, or any
modified
antibody. As another method, the cell is inhibited by administration of a
vaccine
composition as described in detail herein.
The invention further features a method of inhibiting (e.g., inhibiting growth
or
replication) of a microbial cell, in particular, a methanogen cell,
comprising: a)

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
8
=
optionally, producing or isolating at least one antibody as disclosed herein;
and b)
contacting the cell with the antibody. In a particular aspect, the antibody is
directed to at
least a fragment of any one of SEQ ID NO: 5867-7584, or a modified sequence
thereof.
= In certain aspects, the antibody further comprises at least one cell
inhibitor, attached,
for example, as a fusion or conjugate. In other aspects, the antibody is
administered to
a subject as a composition, e.g., a vaccine composition.
Additionally, the invention features a method of inhibiting (e.g., inhibiting
growth or
replication) of a microbial cell, in particular, a methanogen cell,
comprising: a)
optionally, producing or isolating at least one peptide or polypeptide as
disclosed
herein; and b) administering the peptide or polypeptide to a subject to induce
an
immune response thereto. In a particular aspect, the peptide or polypeptide
comprises
at least one amino acid sequence selected from the group consisting of SEQ ID
NO:
5867-7584, or a modified sequence thereof. In other aspects, the peptide or
polypeptide
is administered to a subject as a composition, e.g., a vaccine composition.
The invention furthermore features a method of detecting and/or measuring the
levels of
a polypeptide, in particular, a cell surface polypeptide, or corresponding
peptides or
polynucleotides, comprising: 1) contacting a sample from a subject with an
antibody
directed to the polypeptide (e.g., at least a fragment of any one of SEQ ID
NO: 5867-
7584, or a modified sequence thereof), or a corresponding peptide or
polynucleotide
(e.g., at least a fragment of one of SEQ ID NO: 1-1718, or a modified sequence
thereof); and 2) determining the presence or levels of the antibody complex
formed with
the corresponding polypeptide, peptide, or polynucleotide in the sample. Such
methods
can also be used for detecting and/or measuring the levels of a microbial
cell, in
particular, a methanogen cell.
The invention also features a method of detecting and/or measuring the levels
of a
polynucleotide, in particular, a polynucleotide encoding a cell surface
component,
30. comprising: 1) contacting a sample from a subject with a complementary
polynucleotide (e.g., a sequence complementary to at least a fragment of any
one of
SEQ ID NO: 1-1718, or a modified sequence thereof); and 2) determining the
presence
or levels of the hybridization complex formed with the polynucleotide in the
sample.
Such methods can also be used for detecting and/or measuring the levels of a
microbial
cell, in particular, a methanogen cell.

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
9
In particular aspects, the methods of the invention utilize in vivo or in
vitro expression
components. In other aspects, the methods employ peptides, polypeptides,
polynucleotides, or antibodies produced by recombinant, synthetic, or semi-
synthetic
.. means, or by endogenous means. .
Other aspects and embodiments of the invention are described herein below.
BRIEF DESCRIPTION OF THE DRAWINGS
This invention is described with reference to specific embodiments thereof and
with
reference to the figures.
FIG. 1: Chemogenomic and vaccine gene targets within M1. The number of genes
identified by each analysis is shown in the Venn diagram and a selection of
the gene
.. targets are summarized in the tables grouped by functional category (a)
Chemogenomic
gene targets were defined by identification 'of genes that occurred across
three separate
analyses; the Functional Genome Distribution (FGD), Differential BLAST
analysis (DBA)
and metabolic profiling. (b) Vaccine target genes were defined as described
and
discussed below. TMH, transmembrane helices, SP, signal peptide.
FIG. 2: GC analysis. Base-pair scale (outer circle), G+C content (middle
circle) and GC
skew (inner circle, (G-C/G+C), darker shade indicates values >1, lighter shade
<1.
Genonnes of the Methanobacteriales order display a DNA skew similar to
bacterial
chromosomes. In M. ruminantium M1 the origin of replication (oriC) was
identified as
being immediately upstream of the Cdc6-1 gene (mru0001) based on GC skew
analysis
and homology to the origin of replication experimentally verified for M.
thennoautotrophicus (Reymond et al., 2004). As with other Methanobacteriales
genomes, M. ruminantium M1 contains a second Cdc6 homolog (mru0423). It also
contains a truncated third Cdc6 homolog within the prophage sequence.
FIG. 3: PROmer alignments (De!cher et al., 2003) of M. ruminantium M1 against
complete Methanobacteriales genomes. Whenever the two sequences agree, a
shaded
line or dot is plotted. The forward matches are displayed in the lighter
shade, while the
reverse matches are plotted in the darker shade. Where the two sequences were
perfectly identical, a single lighter line would extend from the bottom left
to the top right.

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
=
An X-shape pattern is visible is all three synteny plots indicating moderately
diverged
Methanobacteriales genomes. It has been proposed that the X-pattem is
generated by
symmetric chromosomal inversions around the origin of replication
(Emanuelsson,
2007). Units displayed in base-pairs.
5
FIG. 4: Consensus sequence of forty-four C-terminal regions (200 amino acids)
from
= adhesin-like proteins of M. ruminantium M1 (A). LogoBar display of this
consensus. In
both figures region of homology to Big_1 domain (Pfam02369) is highlighted in
grey
(B).
FIG. 5: Proposed biosynthetic pathway for pseudomurein in M1 (Kandler and
KOnig H,
1998; Konig et al., 1994). The disaccharide backbone of M. ruminantium M1
pseudomurein consists of N-acetylgalactosamine (GaINAc) and N-
acetyltalosanninuronic acid (TaINAc) in a (3(1-3) linkage. TalNac has not been
detected
as a monomer and it is believed to be formed during the synthesis of the
disaccharide
probably by epimerization and oxidation of UDP-GaINAc (Step 1). Synthesis of
the
pentapeptide involved, in crosslinking is believed to start with UDP-glutamic
acid
followed by stepwise addition of L-amino acids (Step 2). The amino acids found
in the
pentapeptide are usually alanine, lysine (Lys) and glutamic acid (Glu), but M.
ruminantium M1 is reported to contain threonine (Thr) instead of alanine
(Kandler and
KOnig, 1978). The UDP activated pentapetide is linked to the disaccharide to
give a
UDP-disaccharide pentapeptide (Step 3) which is subsequently translocated to
the
membrane via covalent bond formation with a membrane embedded undecaprenyl
phosphate (Step 4). Following their intracellular biosynthesis the
pseudomurein
repeating units must be exported and assembled. Homologs of the E. coil
peptidoglycan
lipid II flippase (MurJ) have been reported for pseudomurein producing
methanogens
(Ruiz, 2008; Step 5), but there are no genes similar to the penicillin binding
proteins that
carry out the transglycosylation (Step 6) and transpeptidation reactions in
bacterial
peptidoglycan assembly. Peptide crosslinking of pseudomurein requires removal
of a
terminal residue of one peptide and linkage from a glutamic acid to the lysine
of an
adjacent peptide (Step 7), and is probably carried out by transglutaminases.
None of
the enzymes involved in pseudomurein biosynthesis have been characterized, but
analysis of the genome sequence has suggested candidates to carry out several
of the
steps. Several of these have homologs only in those methanogens with
pseudomurein-
=

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
11
containing cell walls. Two other transmembrane proteins of unknown function
(mru1585
and mru1635) are also only found in pseudomurein-containing species.
FIG. 6: (a) PFGE of genomic DNA from Ml. Lane 1, A ladder (New England
Biolabs);
Lane 2, ApallBssHII double digest; Lane 3, Apal digest; Lane 4, MU digest;
Lane 5,
Sizes of Miul fragments. The bands in the A ladder are multiples of 48.5 kb.
(b) In silk
restriction map of the M1 chromosome showing the position and fragment size of
the
M/u1 digest.
FIG. 7: Gene organisation of three clusters proposed to be involved in
secondary
metabolite metabolism in Ml. Clusterl. Mru0068 is predicted to encode two non-
ribosomal peptide synthetase (NRPS) modules, each containing condensation,
adenylation and thiolation domains. The presence of a condensation domain in
the first
module is often associated with NRPSs that make N-acylated peptides (Steller
et al.,
1999). The second module is followed by a terminal thioester reductase domain
which
is thought to release the peptide from the final thiolation domain. Mru0068 is
surrounded by genes that encode two serine phosphatases (mru0066, mru0071), an
anti-sigma factor antagonist (mru0067) and a MatE efflux family protein
(mru0069)
which are likely to be involved in environment sensing, regulating NRPS
expression and
export of the NRP, respectively. Cluster2. The second NRPS gene (mru0351)
contains
4 modules and a C-terminal thioester reductase domain. Immediately downstream
of
mru0351 is another MatE efflux family protein (mru0352), presumably involved
in the
efflux of the NRP. Cluster3. A small cluster of genes elsewhere in the genome
(mru0513-0516) appears to encode NRPS-associated functions. The cluster
includes a
4'-phosphopantetheinyl transferase (mru0514) which primes NRPSs by adding a
phosphopantetheinyl group to a conserved serine within the thiolation domain,
an
acyltransferase (mru0512) possibly involved in NRP acylation, a serine
phosphatase
(mru0515), an anti-sigma factor antagonist (mru0513), and an anti-sigma
regulatory
factor serine/threonine protein kinase (mru0516) that may function in sensing
the
environment and NRPS regulation. Although the products of each NRPS are
unknown,
an analysis of adenylation domain amino acid sequences by NRPSpredictor
(Rausch et
al., 2005) predicts 10 residues which are important for substrate binding and
catalysis.
FIG. 8: Effect of the lytic enzyme PeiR on M1 growth in vitro. (A) Addition of
PeiR to
growing cultures at 73 h resulted in a dramatic drop in culture density,
indicative of cell

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
12
lysis. At a low concentration of PeiR (final concentration of 2.5 mg per
litre), the cultures
were able to recover, indicated by the increase in culture density after 100
h, and (B) by
production of methane at levels similar to that of cultures receiving no PeiR.
Addition of
higher concentrations of PeiR (7.5 and 22.5 mg per litre) resulted in a
lasting effect, with
(A) no subsequent recovery of growth and (B) a reduced methane yield.
Chloroform, a
known potent inhibitor of methanogens, resulted in a similarly reduced methane
yield
(B), but the decrease in culture density was less (A), as expected since it
halts
metabolism rather than lysing cells. PeiR was added to 10 ml cultures in 0.1
ml of
beer. The buffer alone had no effect. The symbols (A) and solid bars (B) are
means of
3 replicates, and the thin vertical bars represent one standard error on
either side of the
mean.
FIG. 9: Observation of interspecies interactions between M. ruminantium M1 and
B.
proteoclasticus B316-r. Graph displays growth rate of M1 in co-culture with
B316.
= 15 Microscopic images taken at 2, 8 and 12 h post inoculation of
B316 (lighter, rod-shaped
organism) into BY+(+0.2% xylan) media containing a mid-exponential M1 culture
(darker, short ovoid rod-shaped organism). Growth as determined by Thoma slide
enumeration, is shown along with sampling time.
FIG. 10: Genome atlas of M. ruminantium Ml. The circle was created using
Genewiz
(Jensen et al., 1999) and in house developed software. The right-hand legend
describes the single circles in the top-down- outermost-innermost direction.
Outermost
1st ring: Differential Blast Analysis between the non-redundant (nr) database
(Ring 3)
and a custom methanogen database (Ring 2). Regions in medium-dark shading
indicate protein sequences highly conserved between M. ruminantium and at
methanogens but not found in the nr database. Regions in darker shading
indicate
protein sequences conserved between M. ruminantium and the nr database but not
present in other methanogens genomes. 2nd ring: gapped BlastP results using a
custom
methanogen database consisting of publicly accessible genome project sequences
(Table 10), Td ring: gapped BlastP results using the non-redundant database
minus
published methanogen genome project sequences. In both rings, regions in
medium-
dark shading represent unique proteins in M. ruminantium, whereas highly
conserved
features are shown in darker shading. The degree of colour saturation
corresponds to
the level of similarity. 4th ring: G+C content deviation: medium shading
highlights low-
GC regions, light shading high-GC islands. Annotation rings 5 and 6 indicate
absolute

CA 02772224 2012-02-24
= WO 2011/025394
PCT/NZ2010/000169
13
position of functional features as indicated. 7th ring: ORF orientation. ORFs
in sense
orientation (ORF+) are shown in dark shading; ORFs oriented in antisense
direction
(ORF-) are shown in medium-dark shading. 8th ring: prediction of membrane
bound and
cell surface proteins. White: no transmembrane helices (TMH) were identified,
Black:
ORFs with at least one TMH, Medium-dark shading: ORFs predicted to encompass a
Signal Peptide sequence and Medium shading: ORFs predicted to incorporate both
TMH and SignalP domains. 9th ring: COG classification. COG families were
assembled
into 5 major groups: information storage and processing (light shading);
cellular
processes and signalling (medium shading); metabolism (light-medium shading);
poorly
characterized (dark shading); and ORFs with uncharacterized COGs or no COG
assignment (grey). 10th ring: GC-skew. Innermost ring: genome size (Mb).
Selected
features representing single ORFs are shown outside of circle 1 with bars
indicating
their absolute size. Origin and terminus of DNA replication are identified in
light-medium
shading and dark-medium shading, respectively.
FIG. 11: Methanogenesis pathway. The predicted pathway of methane formation in
M1
based on the scheme of Thauer et al. (Thauer et al., 2008) for methanogens
without
cytochromes. The pathway is divided into three partitions; capture of
reductant (left
side, medium shaded background), reduction of CO2 (centre, lighter shaded
background) and energy conservation (right side, darker shaded background).
The
main reactions are indicated by thick arrows and enzymes catalysing each step
are
coloured green. Cofactor participation is indicated with thin arrows. Membrane
located
proteins are coloured light brown and potential vaccine and chemogenomic
targets are
labelled with a circled V or C respectively. Small upwards arrows signify up-
regulated
genes during co-culture with Butyrivibrio proteoclasticus. Full gene names and
corresponding locus tag numbers can be found in Table 9, below. H4MPT;
tetrahydromethanopterin; MF, methanofuran; F420, co-factor F420 oxidised;
F420F12, co-
factor F420 reduced; Fed(dx)?, unknown oxidised ferredoxin; Fed(1ed)? ,
unknown reduced
ferredoxin; HSCoM, reduced coenzyme M; HSCoB, reduced coenzyme B, CoBS-
SCoM, coenzyme B-coenzyme M heterodisulphide; NADP+, nicotinamide adenosine
dinucleotide phosphate non-reduced; NADPH, nicotinamide adenosine dinucleotide
phosphate reduced.
FIG. 12: Cell envelope topography of Ml. Ultrastructural studies of M1 (Zeikus
&
Bowen, 1975; Miller, 2001) show that the cell wall is composed of three layers
and is

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
14
comparable to the organization seen in Gram positive bacteria (Graham &
Beveridge,
1994). The three layers can be described as: (1) a thin electron-dense inner
layer
composed of compacted newly synthesised pseudomurein, (2) a thicker less-
electron-
dense middle layer which is also composed of pseudomurein, and (3) a rough
irregular
outer layer that is distal to the pseudomurein layers and assumed to be
composed of
cell wall glycopolymers, wall. associated proteins and possibly other
components.
Representative adhesin-like proteins with different cell-anchoring domains are
shown.
The number of these proteins predicted in the M1 genome is shown in brackets.
OT,
oligosaccharyl transferase; Sec, Sec protein secretion pathway; PMBR,
pseudomurein
binding repeat (PF09373); M1-C, M1 adhesin-like protein conserved C-terminal
domain.
FIG. 13: Functional Genome Distribution (FGD) of 26 methanogen genomes.
Publicly
available complete genomes were downloaded in GenBank format were possible.
Publicly available draft phase genomes were downloaded in FASTA format,
concatenated using a universal spacer-stop-spacer sequence (TTAGTTAGTTAG; SEQ
ID NO: 7585) and automatically annotated using GAMOLA. Predicted ORFeonnes of
all
genomes were subjected to an FGD analysis and the resulting distance matrix
was
imported into MEGA4 (Samuel et al., 2007). The functional distribution was
visualised
using the UPGMA method (Boekhorst et al., 2005). The optimal tree with the sum
of
branch length = 49.7 is shown. The tree is drawn to scale, with branch lengths
in the
same units as those of the functional distances used to infer the distribution
tree.
Accession numbers for individual genomes can be found in Table 10, below.
=
FIG. 14: Stimulation of growth of M1 by alcohols. The inclusion of (A) 20 mM
methanol
or (B) 5 or 10 mM ethanol when M1 was grown on H2 resulted in an increase in
culture
density (measured as 00600 nm) compared to cultures grown on H2 alone. H2 was
added once only, at the time of inoculation, by gassing the cultures with H2 +
CO2 (4:1)
to 180 kPa overpressure. Higher concentrations of ethanol (20 mM) resulted in
some
inhibition of growth (not shown), and there was no stimulation by isopropanol
(5 to 20
mM; not shown). No growth occurred when cultures were supplemented with
methanol
(A), ethanol (B), or isopropanol (not shown) when no H2 was added, and no
methane
was formed by those cultures. The symbols in panel are means of 4 replicates,
and the
thin vertical bars in panel (A) represent one standard error on either side of
the mean.
Error bars are omitted from panel (B) for the sake of clarity.

15
FIG. 15: Distribution of genes in the predicted ORFeomes of members of the
Methanobacteriales classified according to functional categories in the
archaeal COG
database (Makarova et al., 2007).
FIG. 16: BLAST Heat Map depicting BLAST-result distribution across the M.
ruminantium M1 ORFeome. In both figures, the X-axis (horizontal axis) shows
all
genera with at least 500 and 250 Blast hits throughout the ORFeome,
respectively.
Genera are phylogenetically sorted based on a semi-dynamically re-parsed
phylogenetic tree obtained from the Ribosomal Database Project II (RDP II),
selecting NCB' taxonomy,
level 10 genera display list and set to include archaeal sequences. Bacterial
or archaeal
genera not covered within the RDPII data were entered and parsed from a
separate
data file, where appropriate. Phylogenetic distribution and grouping of genera
is
indicated using an ASCII based tree-abstraction. The Y-axis indicates e-value
ranges,
and the Z-axis (colour coded) represents the frequency of hits for each genus
in each e-
value range in log-scale. Respective Log-colour-scales of frequencies are
indicated in
each figure, whereby warmer colours indicate higher frequencies. Figure (a)
allows all
BLAST hits per genus per ORF, accepting multiple genus hits per ORF. Figure
(b)
employs a frequency cutoff of one hit per genus per ORF, effectively limiting
the hit rate
to the best Blast hit found in each given ORF and genus..
FIG. 17: Sheep antibody responses to vaccination with peptides designed
against M.
ruminantium H4MPT methyltransferase subunits (MtrCDE) and surface proteins and
binding of antibodies to immobilised M. ruminantium cells. (a) Vaccination
with peptides
designed against M1 genes. (b) Binding of antibodies to immobilised M1 cells.
In the
antibody-binding experiment a negative control (NC) serum from a sheep which
had not
had colostrum as a lamb was included, as was a sample without added serum
which
served as a blank, B.
FIG. 18: NRPS alignment. ClustalW (Larkin et al., 2007) alignment of non-
ribosomal
peptide synthetases from M. ruminantium M1 (mru00068) and Syntrophomonas
wolfei
subsp. wolfei str. Goettingen (swo11094). Alignment was visualised using
Jalview
(Waterhouse et al., 2009). Conserved residues are shown in medium shading.
Domain
organisation of M. ruminantium M1 is displayed via boxes (box marked with
rounded
brackets = condensation domain; box marked with pointed brackets = adenylation
CA 2772224 2019-03-25

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
16
domain; box marked with triangle = phosphopantetheine attachment site; box
marked
with double arrow = thioester reductase domain).
FIG. 19: Mbb. ruminantium Ai& ATP synthase PCR cloning and introduction of a
hexa-
histidine tag at the N-terminal of subunit A by PCR overlap expression. (A)
PCR overlap
extension; (B) digested insert; (C) ligation.
FIG. 20: M. smith!! Al& ATP synthase PCR cloning and introduction of a hexa-
histidine
tag by PCR overlap expression. (A) Cloning; (B) PCR overlap extension; (C)
digested
insert and ligation.
FIG. 21: (A) pTrMbrA1HIS clone which contains the genes encoding for the M.
, ruminantium Al-ATPase in the E. coli expression vector pTrc99a, and
includes a Hexa-
Histidine tag on the N-terminal of Subunit A. (B) pTrMbrA1A0HIS9 clone.
FIG. 22: Western blot analysis of pTrMbrA1HIS expression. Lane 1: Pre-stain
Protein
Marker; Lane 2: Soluble Material 10 pg; Lane 3: Unbound Material 10 pg; Lane
4: Wash
1, 10 pg; Lane 5: Wash 2, 10 pg; Lane 6: Elutant 1, 10 pg (150 mM lmidazole);
Lane 7:
Elutant 2, 10 pg (150 mM Imidazole); Lane 8: Elutant 2, 20 pg; Lane 9: Elutant
2, 20 pg,
Denatured 95 C 5 min; Lane 10: Soluble Material 10 pg, Denatured 95 C 5 min.
FIG. 23: Western blot analysis of pTrMbsA1HIS expression. Lane 1: Pre-stain
Protein
Marker; Lane 2: C41-pLysRARE/pTrMbsA1HIS starting material; Lane 3:
pTrMbsA1HIS s
unbound material; Lane 4: pIrMbsA1HIS Wash 1, 40 mM imidazole; Lane .5:
pTrMbsA1HIS Wash 2, 40 mM imidazole; Lane 6: pTrMbsA1HIS Elutant 1, 150 mM
imidazole; Lane 7: pTrMbsA1HIS Elutant 2, 150 mM imidazole; Lane 8:
pIrMbsA1HIS
Elutant 3, 400 mM imidazole.
FIG. 24: Growth of E. coil strains 8L21 (A), DK8 (B) and C41 (C) harbouring
pTRMbbr-
AlAo at 37 C, showing the effect of induced expression of the Mbb.
ruminantium A1A0-
ATP synthase. (D) Localization of the Mbb. ruminantium AiAo-ATPase in 0K8 by
SDS-
PAGE and western analysis. Samples were resolved on a 14% polyacrylamide gel
in
the presence of 0.1% sodium dodecyl sulfate (SDS) and either stained with
Coomassie
Brilliant blue or transferred for western analysis to a polyvinylidene
difluoride membrane
in the presence of 0.02% SDS and then immunoblotted using a penta-His antibody

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
17
conjugate to detect the hexa-histidine tag on the A-subunit. Lane 1, protein
molecular
weight ladder; Lane 2, His-tagged TA2.A1 F1F0 ATPase purification (positive
control);
Lane 3, cell lysate; Lane 4, cytoplasmic fraction; Lane 5, membrane fraction.
FIG. 25: Purification (A and B) of the Mbb. ruminantium AlAo-ATPase.
FIG. 26: Subunits of the Mbb. ruminantium Aik-ATPase.
FIG. 27: Extraction of the AlAcrATPase.K-subunit monomer.
FIG. 28: Nat binding motif in the A1A0-ATPase K-subunit.
FIG. 29: Mbb. ruminantium purified AlA, ATP synthase activity. (A) Kinetics of
ATP
hydrolysis by purified Mbb. ruminantium AlA, ATP synthase. Background ATPase
activity generated by thermal hydrolysis of ATP or contaminant ATP in buffer
or enzyme
has been subtracted (these totalled <5 % of the final value shown). (B)
Influence of
Mg2t on the kinetics of ATP hydrolysis by purified recombinant Mbb.
ruminantium AiA,õ
ATP synthase. Background ATPase activity generated by thermal hydrolysis of
ATP or
contaminant ATP in buffer or enzyme has been subtracted (these totalled <5 %
of the
final value shown). (C) ATPase activity over a pH range in the presence and
absence of
Nat. Background ATPase activity generated by thermal hydrolysis of ATP or
contaminant ATP in buffer or enzyme has been subtracted from the activities
displayed
(these totalled <5 % of the final value shown). (D) Stability of the purified
and
membrane-bound (in DK8 membranes) Mbb. ruminantium A1A0 ATP synthase.
.. Background ATPase activity generated by thermal hydrolysis of ATP or
contaminant
ATP in buffer or enzyme has been subtracted (these totalled <5 % of the final
value
shown).
FIG. 30: Mbb. ruminantium soluble and membrane-bound AiA, ATP synthase
activity.
(A and B) Effects of TBT and DCCD on ATPase activity. E. coli DK8 (Aatp)
inverted
membranes containing the recombinant AlAo-ATPase were used to determine the
effects of the inhibitors TBT (200 pM) and DCCD (250 pM) at different pH
values.
ATPase activity was measured in presence of 130 mM Nat (A) and in absence of
Nat
(B). Background ATPase activity generated by thermal hydrolysis of ATP or
contaminant ATP in buffer or enzyme has been subtracted (these totalled <5 %
of the

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
18
final value shown). (C) Tributylin Inhibition of ATP Hydrolysis by Purified
Recombinant
Mbb. ruminantium AlA. ATP synthase. Background ATPase activity generated by
thermal hydrolysis of ATP or contaminant ATP in buffer or enzyme has been
subtracted
(these totalled <5 % of the final value shown). (D) Amiloride Inhibition of
ATP Hydrolysis
of the Mbb. ruminantium AiA, ATP synthase. Background ATPase activity
generated by
thermal hydrolysis of ATP or contaminant ATP in buffer or enzyme has been
subtracted
(these totalled <5 % of the final value shown).
FIG. 31: Mbb. ruminantium membrane-bound AlA, ATP synthase activity. (A)
Tributylin
Inhibition of ATP Hydrolysis by the Mbb. ruminantium Aik ATP synthase in DK8
and
Native Membranes. Background ATPase activity generated by thermal hydrolysis
of
ATP or contaminant ATP in buffer or enzyme has been subtracted (these totalled
<5 %
of the final value shown). (B) Amiloride Inhibition of ATP Hydrolysis of
Purified
Recombinant Mbb. ruminantium Alk ATP synthase in DK8 and Native Membranes.
Background ATPase activity generated by thermal hydrolysis of ATP or
contaminant
ATP in buffer or enzyme has been subtracted (these totalled <5 % of the final
value
shown).
FIG. 32: ATP synthesis in E. coil DK8 inverted membrane vesicles. Closed
squares with
no DCCD; closed triangles, a 20 min preincubation with 250 tiM TBT.
FIG. 33: Model of the.membrane-associated sodium ion-translocating
methyltransferase
complex from methanogenic archaea.
FIG. 34: SDS-PAGE analysis of mtrF-His, mtrG-His, mtrH-His and mtrEDCBAFGH-His
expression in E. coil C41 (IPTG induction, at 37 C for 5 hr).
FIG. 35: SDS-PAGE analysis of mtrA-His, nntre-His, mtrD-His, mtrE-His, mtrH-
His and
mtrEDCBAFGH-His expression in E. coil C43 (IPTG induction, at 37 C for 4 hr).
FIG 36: Western Blot analysis of M. ruminantium surface protein antisera
against M1
cell fraction. Pre: sera obtained before immunisation; Post: sera obtained
after
. immunisation.

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
19
FIG. 37: (A) The a282y2 subunit structure of MCR which contains two nickel
porphinoid
F430 rings and two molecules each of methylcoenzyme M (CoM) and coenzyme B
(CoB). (B) The final reaction of the energy conserving pathway of methanogenic
archaea in which CoM and CoB are converted to methane and the heterodisulfide
= 5 product CoM-S-S-CoB.
FIG. 38: Optical cell density was measured in pure culture over time to assess
the
effectiveness of potential inhibitors.
- DETAILED DESCRIPTION OF THE INVENTION
Definitions
The term "antibody" should be understood in the broadest possible sense and is
intended to include intact monoclonal antibodies and polyclonal antibodies. It
is also
intended to cover fragments and derivatives of antibodies so long as they
exhibit the
desired biological activity. Antibodies encompass immunoglobulin molecules and
immunologically active portions of immunoglobulin (Ig) molecules, i.e.,
molecules that
contain an antigen binding site that specifically binds (immunoreacts with) an
antigen.
These include, but are not limited to, polyclonal, monoclonal, chimeric,
single chain, Fc,
Fab, Fab', and Fab2fragments, and a Fab expression library.
Antibody molecules relate to any of the classes IgG, IgM, IgA, IgE, and IgD,
which differ
from one another by the nature of heavy chain present in the molecule. These
include
subclasses as well, such as IgG1, IgG2, and others. The light chain may be a
kappa
chain or a lambda chain. Reference herein to antibodies includes a reference
to all
classes, subclasses, and types. Also included are chimeric antibodies, for
example,
monoclonal antibodies or fragments thereof that are specific to more than one
source,
e.g., one or more mouse, human, or ruminant sequences. Further included are
camelid
antibodies or nanobodies. It will be understood that each reference to
"antibodies" or
any like term, herein includes intact antibodies, as well as any fragments,
alterations,
derivatives, or variants thereof.
"Altered" polynucleotides encoding peptides, polypeptides, or antibodies, as
used
herein, include those with deletions, insertions, or substitutions of
different nucleotides
resulting in a polynucleotide that encodes the same or functionally equivalent
sequence.

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
=
The encoded peptide, polypeptide, or antibody may also be "altered" and
contain
deletions, insertions, or substitutions of amino acid residues which produce a
silent
change and result in a functionally equivalent sequence. Deliberate amino acid
substitutions may be made on the basis of similarity in polarity, charge,
solubility,
5 hydrophobicity, hydrophilicity, and/or the amphipathic nature of the
residues as long as
the biological activity (e.g., cell association, membrane association) or
immunogenic/immunological activity is retained. For example, negatively
charged amino
acids may include aspartic acid and glutamic acid; positively charged amino
acids may
include lysine and arginine; and amino acids with uncharged polar head groups
having
10 similar hydrophilicity values may include leucine, isoleucine, and
valine, glycine and
alanine, asparagine and glutamine, serine and threonine, and phenylalanine and
tyrosine.
The amino acid molecules as noted herein, refer to oligopeptides, peptides,
15 polypeptides, proteins or antibodies, and any fragments thereof, and to
any naturally
occurring, recombinant, synthetic, or semi-synthetic molecules. These
molecules of the
invention comprise at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 100, 150,
200, 250
amino acids, preferably at least 5 to 10, 10 to 20, 20 to 30, 30 to 40, 40 to
50, 50 to 100,
100 to 150, 150 to 200, 200 to 250, or at least 300, 350, 400, 450, or.500
amino acids.
20 Such amino acid sequences preferably retain the biological activity
(e.g., effect on cell
growth) or the immunogenicity/immunological activity of the molecule. The
amino acid
molecules noted herein are not limited to the complete, native sequence
associated
with the full-length molecule, but include also any fragments, alterations,
derivatives,
and variants thereof.
"Amplification", as used herein, refers to the production of additional copies
of a nucleic
acid sequence and is generally carried out using polymerase chain reaction
(PCR)
technologies well known in the art (Dieffenbach, C. W. and G. S. Dveksler
(1995) PCR
Primer,. a Laboratory Manual, Cold Spring Harbor Press, Plainview, NY).
The terms "biologically active" or "functional," as used herein, refer to a
peptide or
polypeptide retaining one or more structural, immunogenic, or biochemical
functions
(e.g., cell association, membrane association) of a naturally occurring
sequence.

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
21
The terms "cell inhibitor" or "inhibitor," as used herein, refer to agents
that decrease or
= block the growth or replication of microbial cells, especially methanogen
cells. A cell
inhibitor can act to decrease or block, for example, cellular division. An
inhibitor can
= decrease or block, for example, DNA synthesis, RNA synthesis, protein
synthesis, or
post-translational modifications. An inhibitor can also decrease or block the
activity of
enzymes involved in the methanogenesis pathway. An inhibitor can also target a
cell for
recognition by immune system components. Inhibition of a cell also includes
cell killing
and cell death, for example, from lysis, apoptosis, necrosis, etc. Useful
inhibitors
include, but are not limited to, anti-methanogenesis compounds (e.g.,
bronnoethanesulphonic acid), antibodies and antibody fragments, lytic enzymes,
peptide
nucleic acids, antimicrobial peptides, and other antibiotics as described in
detail herein.
The terms "complementary" or "complementarity," as used herein, refer to the
natural
binding of polynucleotides under permissive salt and temperature conditions by
base-
pairing. For the sequence A-G-T, the complementary sequence is T-C-A, the
reverse
complement is A-C-T and the reverse sequence is T-G-A. Complementarity between
two single stranded molecules may be partial, in which only some of the
nucleic acids
bind, or it may be complete when total complementarity exists between the
single
stranded molecules. The degree of complementarity between nucleic acid strands
has
significant effects on the efficiency and strength of hybridization between
nucleic acid
strands. This is of particular importance in amplification reactions, which
depend upon
binding between nucleic acids strands and in the design and use of PNA
molecules.
As used herein, "computer readable media" refers to any medium which can be
read
and accessed directly by a computer. A "computer-based system" refers to the
hardware means, software means, and data storage means used to analyze the
sequence information of the present invention.
The term "derivative", as used herein, refers to the chemical modification of
a nucleic
acid encoding a peptide, polypeptide, or antibody, or a nucleic acid
complementary
thereto. Such modifications include, for example, replacement of hydrogen by
an alkyl,
acyl, or amino group. In preferred aspects, a nucleic acid derivative encodes
a peptide,
polypeptide, or antibody which retains a biological or
immunogenicity/immunological
activity of the natural molecule. A derivative peptide, polypeptide, or
antibody is one
which is modified by glycosylation, pegylation, or any similar process which
retains one

22
or more biological function (e.g., cell association, membrane association) or
immunogenicity/immunological activity of the sequence from which it was
derived.
The term "homology", as used herein, refers to a degree of complementarity.
There may
be partial homology (i.e., less than 100% identity) or complete homology
(i.e., 100%
identity). A partially complementary sequence that at least partially inhibits
an identical
sequence from hybridizing to a target nucleic acid is referred to using the
functional
term "substantially homologous." The inhibition of hybridization of the
completely
complementary sequence to the target sequence may be examined using a
hybridization assay (e.g., Southern or northern blot, solution hybridization
and the like)
under conditions of low stringency. A substantially homologous sequence or
hybridization probe will compete for and inhibit the binding of a completely
homologous
sequence to the target sequence under conditions of low stringency. This is
not to say
that conditions of low stringency are such that non-specific binding is
permitted; low
stringency conditions require that the binding of two sequences to one another
be a
specific (i.e., selective) interaction.
The term "hybridization", as used herein, refers to any process by which a
strand of
nucleic acid binds with a complementary strand through base pairing.
An "immunogenic epitope" is defined as a part of a protein that elicits an
antibody
response when the whole protein is the immunogen. On the other hand, a region
of a
protein molecule to which an antibody can bind is defined as an "antigenic
epitope."
An "insertion" or "addition", as used herein, refers to a change in an amino
acid or
nucleotide sequence resulting in the addition of one or more amino acid
residues or
nucleotides, respectively, as compared to the naturally occurring molecule.
A "methanogen," as used herein, refers to microbes that produce methane gas,
which
include Methanobrovibactor, Methanothermobacter, Methanomicrobium,
Methanobacterium, and Methanosarcina. Specific methanogens include, but are
not
limited to, Methanobrevibacter ruminantiurn (i.e., the M1 strain (also called
"Ml"), or
strain DSM1093,
Methanobrevibacter smithii, Methanobrevibacter acididurans, Methanobrevibacter
thaueri, Methanobacterium bryantii, Methanobacterium formicicum,
=
CA 2772224 2019-03-25

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
23
Methanothermobacter marburgensis, Methanothermobacter wolfeii, Methanosphaera
stadtmanae, Methanomicrobium mobile, Methanosarcina barked, Methanosarcina
mazei, Methanococcoides burtonii, and Methanolobus taylorii. All methanogen
genera
and species are encompassed by this term.
"Microbial" cells as used herein, refers to naturally-occurring or genetically
modified
microbial cells including archaebacteria such as methanogens, halophiles, and
thermoacidophiles, and eubacteria, such as cyanobacteria, spirochetes,
proteobacteria,
as well as Gram positive and Gram negative bacteria.
The term "modified" refers to altered sequences and to sequence fragments,
variants,
and derivatives, as described herein.
The nucleic acid molecules as noted herein refer to polynucleotides,
oligonucleotides,
or fragments thereof, and to DNAs or RNAs of natural, recombinant, synthetic
or semi-
synthetic, origin which may be single or double stranded, and can represent
sense or
antisense strands, or coding or non-coding regions, or intergenic regions.
These
molecules of the invention preferably comprise at least 12, 15, 30, 45, 60,
75, 90, 105,
120, 135, 150, 300, 450, 600, 750 nucleotides, preferably at least 15 to 30,
30 to 60, 60
to 90, 90 to 120, 120 to 150, 150 to 300, 300W. to 450, 450 to 600, or 600 to
750
nucleotides, or at least 800, 850, 900, 950, 1000, 1200, 1300, 1400, or 1500
, nucleotides. It will be understood that a nucleic acid molecule as noted
herein, will
include the native, full length sequence, as well as any complements,
fragments,
alterations, derivatives, or variants, thereof.
The term "oligonucleotide" refers to a nucleic acid sequence of at least 6, 8,
10, 12, 15,
18, 21, 25, 27, 30, or 36 nucleotides, or at least 12 to 36 nucleotides, or at
least 15 to
nucleotides, which can be used in PCR amplification, sequencing, or
hybridization
assays. As used herein, oligonucleotide is substantially equivalent to the
terms
30 "amplimers," "primers," "oligomers," and "probes," as commonly defined
in the art.
The term "polynucleotide," when used in the singular or plural, generally
refers to any
nucleic acid sequence, e.g., any polyribonucleotide or polydeoxribonucleotide,
which
may be unmodified RNA or DNA or modified RNA or DNA. This includes, without
limitation, single and double stranded DNA, DNA including single and double

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
24
stranded regions, single and double stranded RNA, and RNA including single and
double stranded regions, hybrid molecules comprising DNA and RNA that may be
single stranded or, more typically, double stranded or include single and
double
stranded regions. Also included are triple-stranded regions comprising RNA or
DNA
or both RNA and DNA. Specifically included are mRNAs, cDNAs, and genomic
DNAs, and any fragments thereof. The term includes DNAs and RNAs that contain
one or more modified bases, such as tritiated bases, or unusual bases, such as
inosine. The polynucleotides of the invention can encompass coding (e.g., SEQ
ID
NO: 1-1718) or non-coding sequences (e.g., SEQ ID NO: 1719-3102 or SEQ ID
NO:7607-7684), or intergenic sequences (e.g., SEQ ID NO: 3103-5866), or sense
or
antisense sequences, or iRNAs such as siRNAs. It will be understood that each
reference to a "polynucleotide" or like term, herein, will include the full
length
sequences as well as any complements, fragments, alterations, derivatives, or
=
variants thereof.
A "peptide" and "polypeptide," as used herein, refer to the isolated peptides
or
polypeptides of the invention obtained from any species, preferably microbial,
from any
source whether natural, synthetic, semi-synthetic, or recombinant.
Specifically, a
peptide or polypeptide of the invention can be obtained from methanogen cells,
such as
Methanobrevibacter cells, in parkular, M. ruminantium, or M. smithii cells.
For
recombinant production, a peptide or polypeptide of the invention can be
obtained from
microbial or eukaryotic cells, for example, Escherichia, Streptomyces,
Bacillus,
Salmonella, yeast, insect cells such as Drosophila, animal cells such as COS
and CHO
cells, or plant cells. It will be understood that each reference to a
"peptide' or
"polypeptide," herein, will include the full-length sequence, as well as any
fragments,
alterations, derivatives, or variants, thereof.
"Peptide nucleic acid" or "PNA" as used herein, refers to an antisense
molecule or anti-
gene agent which comprises bases linked via a peptide backbone.
The term "ruminant," as used herein, refers to animals that have a rumen as a
special
type of digestive organ. Ruminants include, but are not limited to, cattle,
sheep, goats,
buffalo, moose, antelope, caribou, and deer.

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
The term "SEQ ID NO:" refers to a specifically numbered sequence as disclosed
herein.
The format of "SEQ ID NO: #--Ir refers to each sequence taken individually,
and any
combination thereof.
5 The terms "stringent conditions" or "stringency," as used herein, refer
to the conditions
for hybridization as defined by the nucleic acid, salt, and temperature. These
conditions
are well known in the art and may be altered in order to identify or detect
identical or
related polynucleotide 'sequences. See, e.g., Sambrook, J. et al. (1989)
Molecular
Cloning, A Laboratory Manual, Cold Spring Harbor Press, Plainview, NY, and
Ausubel,
10 .. F. M. et al. (1989) Current Protocols in Molecular Biology, John Wiley &
Sons, New
York, NY. Numerous equivalent conditions comprising either low or high
stringency
depend on factors such as the length and nature of the sequence (DNA, RNA,
base
composition), nature of the target (DNA, RNA, base composition), milieu (in
solution or
immobilized on a solid substrate), concentration of salts and other components
(e.g.,
15 formamide, dextran sulfate and/or polyethylene glycol), and temperature
of the
reactions (e.g., within a range from about 5 C below the melting temperature
of the
probe to about 20 C to 25 C below the melting temperature). One or more
factors may
be varied to generate conditions of either low or high stringency different
from, but
equivalent to, the above listed conditions.
The term "subject" includes human and non-human animals. Non-human animals
include, but are not limited to, birds and mammals, such as ruminants, and in
particular,
mice, rabbits, cats, dogs, pigs, sheep, goats, cows, and horses.
The terms "substantially purified" or "isolated" as used herein, refer to
polypeptides,
peptides, or polynucleotides, that are removed from their cellular,
recombinant, or
synthetic environment, and are at least 60% free, preferably 75% free, and
most
preferably at least 90% free or at least 99% free from other components with
which they
are associated in their environment. "Isolated" polynucleotides and
polypeptides have
.. been identified and separated from at least one contaminant molecule with
which they
are associated in their natural state. Accordingly, it will be understood that
isolated
polynucleotides and polypeptides are in a form which differs from the form or
setting in
which they are found in nature. It will further be appreciated that "isolated"
does not
necessarily reflect the exact extent (e.g., a specific percentage) to which
the sequence
has been purified.

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
26
=
"Transformation," as defined herein, describes a process by which exogenous
DNA
enters and changes a recipient cell. It may occur under natural or artificial
conditions
using various methods well known in the art. Transformation may rely on any
known
method for the insertion of foreign polynucleotides into a prokaryotic or
eukanjotic host
cell. The method is selected based on the type of host cell being transformed
and may
include, but is not limited to, viral infection, electroporation, heat shock,
lipofection, and
particle bombardment. Such "transformed" cells include stably transformed
cells in
which the inserted DNA is capable of replication either as an autonomously
replicating
plasmid or as part of the host chromosome. They also include cells which
transiently
express the inserted DNA or RNA for limited periods of time. ,
"Vaccines" as used herein include all components and compositions for
stimulating the
immune response in a subject. Particularly useful in this regard are subunit
vaccines,
including peptide vaccines, and also vectored vaccines, nucleic acid vaccines,
and
edible vaccines. Vaccines can be used to establish or strengthen an immune
response
to an antigen, particularly a microbial antigen. In particular aspects,
vaccines comprise
antigens that evoke host-protective reactions, e.g., antibody formation, T
helper, and T
cell responses. Vaccines can also comprise antibodies, for example, for
passive
immunization.
A "variant" of a peptide, polypeptide, or antibody, as used herein, refers to
an amino
acid molecule that is altered by one or more amino acids. A variant
polynucleotide is
altered by one or more nucleotides. A variant may result in "conservative"
changes,
wherein a substituted amino acid has similar structural or chemical
properties, e.g.,
replacement of leucine with isoleucine. More rarely, a variant may result in
"nonconservative" changes, e.g., replacement of a glycine with a tryptophan.
Analogous
minor variations may also include amino acid deletions or insertions, or both.
Guidance
in determining which amino acid residues may be substituted, inserted, or
deleted
without abolishing biological or immunogenic/immunological activity may be
found using
computer programs well known in the art, for example, LASERGENE software
(DNASTAR).
The invention also encompasses nucleic acid and amino acid variants which
retain at
least one biological activity (e.g., cell association, membrane association)
or

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
27
immunogenicity/imrnunological activity. A preferred variant is one having
substantially
the same or a functionally equivalent sequence, for example, having at least
70%, at
least 75%, at least 80%, at least 85%, and more preferably at least 90%,
sequence
identity to a disclosed sequence. A most preferred variant is one having at
least 95%, at
.. least 97%, at least 98%, or at least 99%, at least 99.5%, at least 99.8%,
or at least
99.9% sequence identity to a sequence disclosed herein. The percentage
identity is
determined by aligning the two sequences to be compared as described below,
determining the number of identical residues/nucleotides in the aligned
portion, dividing
that number by the total number of residues/nucleotides in the= inventive
(queried)
sequence, and multiplying the result by 100. A useful alignment program is
AlignX
(Vector NTI).
Description of the invention
Methane is produced in the foregut of ruminants by methanogens which act as
terminal
.. reducers of carbon in the rumen system. The multi-step rnethanogenesis
pathway is
well- elucidated, mainly from the study of non-rumen methanogens. However, the
adaptations that allow methanogens to grow and persist in the rumen are not
well
Understood. Methanobrevibacter ruminantium (formerly Methanobacterium
ruminantium) is the so-called type species of the Methanobrevibacter genus and
was
isolated from the bovine rumen (Smith, 1958). M. ruminantium is a dominant
methanogen worldwide which is found in ruminants fed a wide variety of diets
(Janssen,
2008). As such, M. ruminantium represents an important target for anti-methane
technology.
We have embarked on a programme to sequence the genomes of cultured
representatives of the main rumen methanogen groups. Defining gene targets
within
rumen methanogens for CH4 mitigation technologies is somewhat akin to
developing a
therapeutic intervention for a microbial pathogen. Therefore, our analysis of
the M.
ruminantium genome is presented with an emphasis on identifying conserved
methanogen surface proteins suitable for vaccine development via reverse
vaccinology
techniques (Rappuoli, 2001) and enzyme targets susceptible to small molecule
inhibitors through a chemogenomics approach (Caron et al., 2001).

CA 02772224 2012-02-24
. WO 2011/025394 PCT/NZ2010/000169
28
In view of this, we have elucidated the full genome sequence of M. ruminantium
and
have identified all of the components of the methanogenesis pathway therein.
Comparison of these gene, sequences with those from Methanobacterium
the rmoautotrophicum and Methanosphaera stadtmanae indicates methanogenesis
gene organisation is conserved within the Methanobacteriales (Figures 1, 10,
13, and
15). The M. ruminantium genome also includes many large surface proteins which
may
mediate association with other rumen microbes. Based on the role of M.
ruminantium in
the rumen environment, the identified polynucleotides and polypeptides can be
used as
a means for inhibiting methanogens and/or methanogenesis, and to further
elucidate
the role of M. ruminantium in methane formation. Particularly useful are the
disclosed
polynucleotides and polypeptides identified as components involved in
methanogenesis
(Tables 2, 4, 5, and 9, below), as cell surface components (Tables 3, 5, 6,
and 9,
below), as components involved in exopolysaccharide biosynthesis (Tables 2, 4,
and 9,
below), as components with membrane spanning domains (Tables 3 and 9, below),
as
components involved in non-ribosomal peptide synthesis (Tables 7 and 9,
below), as
well as the polynucleotides and polypeptides for antibody production (Tables 2
and 9,
below). The specific M. ruminantium sequences are disclosed herewith include
identified ORFs (Table 11), non-coding features (Table 12), and intergenic
regions
(Table 13).
The M1 genome was sequenced, annotated and subjected to comparative genomic
and
metabolic pathway analyses. Conserved and methanogen-specific gene sets
suitable
as targets for vaccine development or chemogenomic-based inhibition of rumen
methanogens were identified. The feasibility of using a synthetic peptide-
directed
vaccinology approach to target epitopes of methanogen surface proteins was
demonstrated. A prophage genome was described and its lytic enzyme,
endoisopeptidase PeiR, was shown to lyse M1 cells in pure culture. A predicted
stimulation of M1 growth by alcohols was demonstrated and microarray analyses
indicated up-regulation of methanogenesis genes during co-culture with a
hydrogen
(H2) producing rumen bacterium. We also report the discovery of non-ribosomal
peptide
synthetases in M. ruminantium Ml, the first reported in archaeal species. The
M1
genome sequence provides new insights into the lifestyle and cellular
processes of this
important rumen methanogen. It also defines vaccine and chemogenomic targets
for
broad inhibition of rumen methanogens and represents a significant
contribution to

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
29
worldwide efforts to mitigate ruminant methane emissions and reduce production
Of
anthropogenic greenhouse gases.
Peptides, polypeptides, and polynucleotides
The invention encompasses peptides and polypeptides, including those
comprising at
least one of SEQ ID NO: 5867-7584, and fragments, variants, and derivatives
thereof. -
The peptides and polypeptides of the present invention may be expressed and
used in
various assays to determine their biological activity. The peptides and
polypeptides may
be used for large-scale synthesis and isolation protocols, for example, for
commercial
production. Such peptides and polypeptides may be used to raise antibodies, to
isolate
corresponding amino acid sequences, and to quantitatively determine levels of
the
e
amino acid sequences. The peptides and polypeptides can be used for vaccines
for
targeting and inhibiting microbial cells, especially methanogen cells. The
peptides and
polypeptides can also be used for preparing antibodies to inhibit the growth
or
replication of such cells. The peptides and polypeptides of the present
invention may
also be used as compositions, for example, pharmaceutical compositions,
especially
vaccine compositions. In particular aspects, slow-release ruminal devices can
be used
in conjunction with the peptides, polypeptides, antibodies, and compositions
(e.g.,
pharmaceutical compositions, especially vaccine compositions) of the
invention.
The peptides of the present invention comprise at least one sequence selected
from the
group consisting of: (a) peptides comprising at least a fragment of an one
amino acid
sequence selected from the group consisting of SEQ ID NO: 5867-7584, or
fragments,
variants, or derivatives thereof; (b) peptides comprising a functional domain
of at least
one amino acid sequence selected from the group consisting of SEQ ID NO: 5867-
7584, and fragments and variants thereof; and (c) peptides comprising at least
a
specified number of contiguous residues (see exemplary lengths hereinabove) of
at
least one amino acid sequence selected from the group consisting of SEQ ID NO:
5867-7584, or variants or derivatives thereof. In one embodiment, the
invention
encompasses an isolated peptide comprising the amino acid sequence of at least
one
of SEQ ID NO: 5867-7584. All of these sequences are collectively, referred to
herein as
peptides of the invention.

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
The polypeptides of the present invention comprise at least one sequence
selected
from the group consisting of: (a) polypeptides comprising at least one amino
acid
sequence selected from the group consisting of SEQ ID NO: 5867-7584, or
fragments,
variants, or derivatives thereof; (b) polypeptides comprising a functional
domain of at
5 least one amino acid sequence selected from the group consisting of SEQ ID
NO:
5867-7584, and fragments and variants thereof; and (c) polypeptides comprising
at
least a specified number of .contiguous residues (see exemplary lengths
hereinabove)
of at least one amino acid sequence selected from the group consisting of SEQ
ID NO:
5867-7584, or variants or derivatives thereof. In one embodiment, the
invention
10 encompasses an isolated polypeptide comprising the amino acid sequence
of at least
one of SEQ ID NO: 5867-7584. All of these sequences are collectively referred
to
herein as polypeptides of the invention.
The invention also encompasses an isolated polynucleotide That encodes a
peptide or
15 polypeptide of SEQ ID NO: 58677584. The isolated polynucleotides of the
present
invention have utility in genome mapping, in physical mapping, and in cloning
of genes
of more or less related cell surface components. Probes designed using the
polynucleotides of the present invention may be used to detect the presence
and
examine the expression patterns of genes in any organism having sufficiently
20 homologous DNA and RNA sequences in their cells, using techniques that are
well
known in the art, such as slot blot techniques or microarray analysis. Primers
designed
using the polynucleotides of the present invention may be used for sequencing
and
PCR amplifications. The polynucleotides of the invention can be used for
preparing
expression vectors and host cells for vaccines to target and inhibit microbial
cells,
25 especially methanogen cells. The invention further encompasses the use of
the
polynucleotides for the production of antibodies to inhibit the growth or
replication of
such cells. The polynucleotides of the present invention may also be used as
compositions, for example, pharmaceutical compositions, especially vaccine
compositions. In particular aspects, slow-release ruminal devices can be used
in
30 conjunction with the polynucleotides, vectors, host cells, and
compositions (e.g.,
pharmaceutical compositions, especially vaccine compositions) of the
invention.
The polynucleotides of the present invention comprise at least one sequence
selected
from the group consisting of: (a) sequences comprising a coding sequence for
at least
one amino acid sequence selected from the group consisting of SEQ ID NO: 5867-

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
31
7584, or fragments or variants thereof; (b) complements, reverse sequences,
and
reverse complements of a coding sequence for at least one amino acid sequence
selected from the group consisting of SEQ ID NO: 5867-7584, or fragments or
variants
thereof; (c) open reading frames contained in the coding sequence for at least
one
amino acid sequence selected from the group consisting of SEQ ID NO: 5867-
7584,
and their fragments and variants; (d) functional domains of a coding sequence
for at
least one amino acid sequence selected from the group consisting of SEQ ID NO:
5867-7584, and fragments and variants thereof; and (e) sequences comprising at
least
a specified number of contiguous residues (see exemplary lengths hereinabove)
of a
coding sequence for at least one amino acid sequence selected from the group
consisting of SEQ ID NO: 5867-7584, or variants thereof; and (f) sequences
comprising
at least a specified number of contiguous nucleotides (see exemplary lengths -
hereinabove) of any one of SEQ ID NO: 1-1718. Oligonucleotide probes and
primers
(e.g., SEQ ID NO: 7586-7607) and their variants are also provided. All of
these
polynucleotides and oligonucleotide probes and primers are collectively
referred to
herein, as polynucleotides of the invention.
It will be appreciated by those skilled in the art that as a result of the
degeneracy of the
genetic code, a multitude of nucleotide sequences encoding the peptides or
polypeptides of the invention, some bearing minimal homology to the nucleotide
sequences of any known and naturally occurring gene, may be produced. Thus,
the
invention contemplates each and every possible variation of nucleotide
sequence that
could be made by selecting combinations based on possible codon choices. These
combinations are made in accordance with the standard triplet genetic code as
applied
to naturally occurring amino acid sequences, and all such variations are to be
considered as being specifically disclosed.
Nucleotide sequences which encode the peptides or polypeptides, or their
fragments or
variants, are preferably capable of hybridizing to the nucleotide sequence of
the
naturally occurring sequence under appropriately selected conditions of
peptide or
stringency. However, it may be advantageous to produce nucleotide sequences
encoding a peptide or polypeptide, or its fragment or derivative, possessing a
substantially different codon usage. Codons may be selected to increase the
rate at
which expression of the peptide or polypeptide occurs in a particular
prokaryotic or
eukaryotic host in accordance with the frequency with which particular codons
are

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
32
utilized by the host. Other reasons for substantially, altering the nucleotide
sequence
encoding peptides or polypeptides and its derivatives without altering the
encoded
amino acid sequences include the production of RNA transcripts having more
desirable
properties, such as a greater half-life, than transcripts produced from the
naturally
occurring sequence.
The invention also encompasses production of DNA sequences, or fragments
thereof,
which encode the peptides or polypeptides, or their fragments or variants,
entirely by
synthetic chemistry. After production, the synthetic sequence may be inserted
into any
of the many available expression vectors and cell systems using reagents that
are well
known in the art. Moreover, synthetic chemistry may be used to introduce
mutations into
a sequence encoding a peptide or polypeptide, or any variants or fragment
thereof. Also
encompassed by the invention are polynucleotide sequences that are capable of
hybridizing to the claimed nucleotide sequences, and in particular, those
shown in SEQ
ID NO: 1-1718, under various conditions of stringency as taught in Wahl, G. M.
and S.
L. Berger (1987; Methods Enzymol. 152:399-407) and Kimmel, A. R. (1987;
Methods
Enzymol. 152:507-511).
Methods for DNA sequencing which are well known and generally available in the
art
and may be used to practice any of the embodiments of the invention. The
methods
may employ such enzymes as the Klenow fragment of DNA polymerase I,
SEQUENASE (U.S. Biochemical Corp, Cleveland, OH), Taq polymerase (Perkin
Elmer), thermostable T7 polymerase Amersham Pharmacia Biotech (Piscataway,
NJ),
or combinations of polymerases and proofreading exonucleases such as those
found in
the ELONGASE Amplification System marketed by Life Technologies (Gaithersburg,
MD). Preferably, the process is automated with machines such as the Hamilton
Micro
Lab 2200 (Hamilton, Reno, NV), Peltier Thermal Cycler (PTC200; MJ Research,
Watertown, MA) the ABI Catalyst and 373 and 377 DNA Sequencers (Perkin Elmer),
or
the Genome Sequencer 2011" (Roche Diagnostics).
The polynucleotides encoding the peptides or polypeptides may be extended
utilizing a
partial nucleotide sequence and employing various methods known in the art to
detect
upstream sequences such as promoters and regulatory elements. For example, one
method which may be employed, "restriction-site" PCR, uses universal primers
to
retrieve unknown sequence adjacent to a known locus (Sarkar, G. (1993) PCR
Methods

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
33
Applic. 2:318-322). In particular, genomic DNA is first amplified in the
presence of
primer to a linker sequence and a primer specific to the known region. The
amplified
sequences are then subjected to a second round of PCR with the same linker
primer
and another specific primer internal to the first one. Products of each round
of PCR are
transcribed with an appropriate RNA polymerase and sequenced using reverse
transcriptase.
Capillary electrophoresis systems which are commercially available may be used
to
analyze the size or confirm the nucleotide sequence of sequencing or PCR
products. In
particular, capillary sequencing may employ flowable polymers far
electrophoretic
separation, four different fluorescent dyes (one for each nucleotide) which
are laser
activated, and detection of the emitted wavelengths by a charge coupled device
camera. Output/light intensity may be converted to electrical signal using
appropriate
software (e.g. GENOTYPER and Sequence NAVIGATOR, Perkin Elmer) and the entire
process from loading of samples to computer analysis and electronic data
display may
be computer controlled. Capillary electrophoresis is especially preferable for
the
sequencing of small pieces of DNA which might be present in limited amounts in
a
particular sample.
In another embodiment of the invention, polynucleotides or fragments thereof
which
encode peptides or polypeptides may be used in recombinant DNA molecules to
direct
expression of the peptides or polypeptides, or fragments or variants thereof,
in
appropriate host cells. Due to the inherent degeneracy of the genetic code,
other DNA
sequences which encode substantially the same or a functionally equivalent
amino acid
sequence may be produced, and these sequences may be used to clone and express
peptides or polypeptides. The nucleotide sequences of the present invention
can be
engineered using methods generally known in the art in order to alter amino
acid-
encoding sequences for a variety of reasons, including but not limited to,
alterations
which modify the cloning, processing, and/or expression of the gene product.
DNA
shuffling by random fragmentation and PCR reassembly of gene fragments and
synthetic oligonucleotides may be used to engineer the nucleotide sequences.
For
example, site-directed mutagenesis may be used to insert new restriction
sites, alter
glycosylation patterns, change codon preference, introduce mutations, and so
forth.

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
34
In another embodiment of the invention, natural, modified, or recombinant
nucleic acid
sequences encoding peptides or polypeptides may be ligated to a heterologous '
sequence to encode a fusion protein. For example, it may be useful to encode a
chimeric sequence that can be recognized by a commercially available antibody.
A
fusion protein may also be engineered to contain a cleavage site located
between the
peptide or polypeptide of the invention and the heterologous protein sequence,
so that
the peptide or polypeptide may be cleaved and purified away from the
heterologous
moiety.
In another embodiment, sequences encoding peptides or polypeptides may be
synthesized, in whole or in part, using chemical methods well known in the art
(see
- Caruthers, M. H. et al. (1980) Nucl. Acids Res. Symp. Ser. 215-223, Horn,
T. et al.
(1980) Nucl. Acids Res. Symp. Ser. 225-232). Alternatively, the polypeptide
itself may
be produced using chemical methods to synthesize the amino acid molecule, or a
fragment thereof. For example, polypeptide synthesis can be performed using
various
solid-phase techniques (Roberge, J. Y. et al. (1995) Science 269:202-204;
Merrifield J.
(1963) J. Am. Chem. Soc. 85:2149-2154) and automated synthesis may be
achieved, -
for example, using the ABI 431A Peptide Synthesizer (Perkin Elmer). Various
fragments
of peptides or polypeptides may be chemically synthesized separately and
combined
using chemical methods to produce the full length molecule.
The newly synthesized peptide or polypeptide may be isolated by preparative
high
performance liquid chromatography (e.g., Creighton, T. (1983) Proteins
Structures and
Molecular Principles, VVH Freeman and Co., New York, NY). The composition of
the
synthetic peptides or polypeptides may be confirmed by amino acid analysis or
sequencing (e.g., the Edman degradation procedure; Creighton, supra).
Additionally,
the amino acid sequence of the peptide or polypeptide, or any part thereof,
may be
altered during direct synthesis and/or combined using chemical methods with
sequences from other proteins, or any part thereof, to produce a variant
molecule.
In order to express a biologically active peptides or polypeptides, the
nucleotide
sequences encoding the sequences or functional equivalents, may be inserted
into an
appropriate expression vector, i.e., a vector which contains the necessary
elements for
the transcription and translation of the inserted coding sequence. Methods
which are
well known to those skilled in the art may be used to construct expression
vectors

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
containing sequences encoding the peptide or polypeptide and appropriate
transcriptional and translational control elements. These methods include in
vitro
recombinant DNA techniques, synthetic techniques, and in vivo genetic
recombination.
Such techniques are described in Sambrook, J. et al_ (1989) Molecular Cloning,
A
5 Laboratory Manual, Cold Spring Harbor Press, Plainview, NY, and Ausubel,
F. M. et al.
(1989) Current Protocols in Molecular Biology, John Wiley & Sons, New York,
NY.
A variety of expression vector/host systems may be utilized to contain and
express
sequences encoding the peptides or polypeptides of the invention. These
include, but
10 are not limited to, microorganisms such as bacteria transformed with
recombinant
phage, plasmid, or cosmid DNA expression vectors; yeast transformed with yeast
expression vectors; insect cell systems infected with virus expression vectors
(e.g.,
baculovirus); plant cell systems transformed with virus expression vectors
(e.g.,
cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or with bacterial
15 expression vectors (e.g., Ti or pBR322 plasmids); or animal cell
systems. For bacteria,
useful plasmids include pET, pRSET, pTrcHis2, and pBAD plasmids from
Invitrogen,
pET and pCDF plasmids from Novagen, and Director114 plasmids from Sigma-
Aldrich.
For methanogens, useful plasmids include, but are not limited to pME2001,
pMV15, and
pMP1. The invention is not limited by the expression vector or host cell
employed.
The "control elements" or "regulatory sequences" are those non-translated
regions of
the vector¨enhancers, promoters, 5' and 3' untranslated regions--which
interact with
host cellular proteins to carry out transcription and translation. Such
elements may vary
in their strength and specificity. Depending on the vector system and host
utilized, any
number of suitable transcription and translation elements, including
constitutive and
inducible promoters, may be used. For example, when cloning in bacterial
systems,
inducible promoters such as the hybrid lacZ promoter of the BLUESCRIPT
phagemid
(Stratagene, LaJolla, CA) or pSPORT1 plasmid (Life Technologies) and the like
may be
used. The baculovirus polyhedrin promoter may be used in insect cells.
Promoters or
enhancers derived from the genomes of plant cells (e.g., heat shock, RUBISCO,
and
storage protein genes) or from plant viruses (e.g., viral promoters or leader
sequences)
may be cloned into the vector.
In bacterial systems, a number of expression vectors may be selected depending
upon
the use intended for the peptide or polypeptide. For example, when large
quantities of

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
36
=
peptide or polypeptide are needed, vectors which direct high level expression
of fusion
proteins that are readily purified may be used. Such vectors include, but are
not limited
to, the multifunctional E. coli cloning and expression vectors such as
BLUESCRIPT
(Stratagene), in which the sequence encoding a polypeptide may be ligated into
the
vector in frame with sequences for the amino-terminal Met and the subsequent 7
residues of j3-galactosidase so that a hybrid protein is produced; pIN vectors
(Van
Heeke, G. and S. M. Schuster (1989) J. Biol. Chem. 264:5503-5509); and the
like.
pGEX vectors (Promega, Madison, WI) may also be used to express peptides or
polypeptides as fusion proteins with 'glutathione S-transferase (GST). In
general, such
fusion proteins are soluble and can easily be purified from lysed cells by
adsorption to
glutathione-agarose beads followed by elution in the presence of free
glutathione.
Proteins made in such systems may be designed to include heparin, thrombin, or
factor
Xa protease cleavage sites-so that the cloned peptide or polypeptide of
interest can be
released from the GST moiety at will. In the yeast, Saccharomyces cerevisiae,
a
number of vectors containing constitutive or inducible promoters such as alpha
factor,
alcohol oxidase, and PGH may be used. For reviews, see Ausubel et al. (supra)
and
Grant et al. (1987) Methods Enzymol. 153:516-544.
Specific initiation signals may also be used to achieve more efficient
translation of
sequences encoding the peptides or polypeptides of the invention. Such signals
include
the ATG initiation codon and adjacent sequences. In cases where sequences
encoding
a peptide or polypeptide, its initiation codon, and upstream sequences are
inserted into
the appropriate expression vector, no additional transcriptional or
translational control
signals may be needed. However, in cases where only coding sequence, or a
fragment
thereof, is inserted, exogenous translational control signals including the
ATG initiation
codon should be provided. Furthermore, the initiation codon should be in the
correct
reading frame to ensure translation of the entire insert. Exogenous
translational
elements and initiation codons may be of various origins, both natural and
synthetic.
The efficiency of expression may be enhanced by the inclusion of enhancers
which are
appropriate for the particular cell system which is used, such as those
described in the
literature (Scharf, D. et al. (1994) Results Probl. Cell Differ. 20:125-162).
In addition, a host cell strain may be chosen for its ability to modulate the
expression of
the inserted sequences or to process the expressed peptide or polypeptide in
the

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
37
desired fashion. Such modifications of the sequence include, but are not
limited to,
acetylation, carboxylation, glycosylation, phosphorylation, lipidation, and
acylation.
Post-translational processing which cleaves a "prepro" form of the peptide or
polypeptide may also be used to facilitate correct insertion, folding, and/or
function.
Different host cells which have specific cellular machinery and characteristic
mechanisms for post-translational activities are available from the American
Type
Culture Collection (ATCC; Bethesda, MD) and may be chosen to ensure the
correct
modification and processing of the sequence. Specific host cells include, but
are not
limited to, methanogen cells, such as Methanobrevibacter cells, in particular,
M.
ruminantium, or M. smithii cells. Host cells of interest include, for example,
Rhodotorula,
Aureobasidium, Saccharomyces, Sporobolomyces, Pseudomonas, Erwinia and
Flavobacterium; or such other organisms as Escherichia, Lactobacillus,
Bacillus,
Streptomyces, and the like. Specific host cells include Escherichia coli,
which is
particularly suited for use with the present invention, Saa charomyces
cerevisiae,
Bacillus thuringiensis, Bacillus subtilis, Streptomyces lividans, and the
like.
There are several techniques for introducing polynucleotides into eukaryotic
cells
_ cultured in vitro. These include chemical methods (Feigner et al., Proc.
Natl. Acad. Sci.,
USA, 847413 7417 (1987); Bothwell et al., Methods for Cloning and Analysis of
Eukaryotic Genes, Eds., Jones and Bartlett Publishers Inc., Boston, Mass.
(1990), _
Ausubel et al., Short Protocols in Molecular Biology, John Wiley and Sons, New
York,
NY (1992); and Farhood, Annal. NY Acad. Sci., 716:23 34 (1994)), use of
protoplasts
(Bothwell, supra) or electrical pulses (Vatteroni et al., Mutn. Res., 291:163
169 (1993);
Sabelnikov, Prog. Biophys. Mol. Biol., 62: 119 152 (1994); Bothwell et al.,
supra; and
Ausubel et al., supra), use of attenuated viruses (Davis et al., J. Viral.
1996, 70(6), 3781
3787; Brinster et al. J. Gen. Virol. 2002, 83(Pt 2), 369 381; Moss, Dev. Biol.
Stan.,
82:55 63 (1994); and Bothwell et al., supra), as well as physical methods
(Fynan et al.,
Int J lmmunopharmacol. 1995 Feb;17(2):79-83; Johnston et al., Meth. Cell
Biol., 43(Pt
A):353 365 (1994); Bothwell et al., supra; and Ausubel et al., supra).
Successful delivery of polynucleotides to animal tissue can be achieved by
cationic
liposomes (Watanabe et al., Mol. Reprod. Dev., 38:268 274 (1994)), direct
injection of
naked DNA or RNA into animal muscle tissue (Robinson et al., Vacc., 11:957 960
(1993); Hoffman et al., Vacc. 12:1529 1533; (1994); Xiang et al., Viral.,
199:132 140
(1994); Webster et al., Vacc., 12:1495 1498 (1994); Davis et al., Vacc.,
12:1503 1509

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
38
(1994); Davis et al., Hum. Molec. Gen., 2:1847 1851 (1993); Dalemans et al.
Ann NY
Acad. Sci. 1995, 772, 255 256. Conry, et at. Cancer Res. 1995, 55(7), 1397-
1400), and
embryos (Naito et al., Mol. Reprod. Dev., 39:153 161 (1994); and Burdon et
al., Mol.
Reprod. Dev., 33:436 442 (1992)), intramuscular injection of self replicating
RNA
vaccines (Davis et al., J Virol 1996, 70(6), 3781 3787; Balasuriya et at.
Vaccine 2002,
20(11 12), 1609 1617) or intradermal injection of DNA using "gene gun"
technology
(Johnston et al., supra).
A variety of protocols for detecting and measuring the expression of the
peptides or
.. polypeptides of the invention, using either polyclonal or monoclonal
antibodies specific
for the protein are known in the art. Examples include enzyme-linked
immunosorbent
assay (ELISA), radioimmunoassay (RIA), and fluorescence activated cell sorting
(FACS). A two-site, monoclonal-based immunoassay can be used with monoclonal
antibodies reactive to two non-interfering epitopes on the peptide or
polypeptide, but a
.. competitive binding assay can also be used. These and other assays are
described,
among other places, in Hampton, R. et al. (1990; Serological Methods, a
laboratory -
Manual, APS Press, St Paul, MN) and Maddox, D. E. et al. (1983; J. Exp. Med.
158:1211-1216).
A wide variety of labels and conjugation techniques are known by those skilled
in the art
and may be used in various nucleic acid and amino acid assays. Means for
producing
labeled hybridization or PCR probes for detecting sequences related to
polynucleotides
= include oligolabeling, nick translation, end-labeling or PCR
amplification using a labeled
nucleotide. Alternatively, the sequences encoding the peptides or
polypeptides, or any
fragments or variants thereof, may be cloned into a vector for the production
of an
mRNA probe. Such vectors are known in the art, are commercially available, and
may
be used to synthesize RNA probes in vitro by addition of an appropriate RNA
= polymerase such as T7, T3, or SP6 and labeled nucleotides. These
procedures may be
conducted using a variety of commercially available kits Amersham Phamnacia
Biotech,
.. Promega, and US Biochemical. Suitable reporter molecules or labels, which
may be
used for ease of detection, include radionuclides, enzymes, fluorescent,
chemiluminescent, or chromogenic agents as well as substrates, cofactors,
inhibitors,
magnetic particles, and the like.

= CA 2772224 2017-03-13
39
=
Expression vectors or host cells transformed with expression vectors may be
cultured
under conditions suitable for the expression and recovery of the peptide or
polypeptide
from culture. The culture can comprise components for in vitro or in vivo
expression. In
vitro expression components include those for rabbit reticulocyte lysates, E.
coil lysates,
and wheat germ extracts, for example, ExpresswayTm or RiPs systems from
InvitrOgen,
GenelatorTm systems from iNtRON Biotechnology, EcoProTm or STP311" systems
from
Novagen, TNT Quick Coupled systems from Promega; and EasyXpress systems. from
QIAGEN. The peptide or polypeptide produced from culture may be secreted or
= contained intracellularly depending on the sequence and/or the vector
used. ' In
- particular aspects, expression vectors which encode a peptide or polypeptide
can be
designed to contain signal sequences which direct secretion of the peptide or
polypeptide through a prokaryotic or eukaryotic cell membrane. Specific signal
peptides
for use herein have been disclosed in detail in US 60/975,104 filed 25
September 2007,
= and in PCT/2008/000247 filed 25 September 2008,
Other constructions may include an amino add domain which will facilitate
purification
of the peptide or polypeptide. Such domains include, but are not limited to,
metal -
chelating domains such as histidine-tryptophan (e.g., 6X-HIS) modules that
allow
purification on immobilized metals, protein A domains that allow purification
on
immobilized immunoglobulin, and the domain utilized in the FLAG
extension/affinity
purification system (Immunex Corp., Seattle, WA). Useful epitope tags include
3XFLAGO, HA, VSV-G, V5, HSV, GST, GFP, MBP, GAL4, and B-galactosidase. Useful
plasmids include those comprising a biotin tag (e.g., PinPointn, plasmids from
Promega), calmodulin binding protein (e.g., pCAL plasmids from Stratagene),
streptavidin binding peptide (e_g_, InterPlayTm plasmids from Stratagene), a c-
myc or
FLAG tag (e.g., Immunoprecipitation plasmids from Sigma-Aldrich), or a
histidine tag
(e.g., QIAExpress plasmids from QIAGEN).
To facilitate purification, expression vectors can include cleavable linker
sequences -
such as those specific for Factor Xa or enterokinase (lnvitrogen, San Diego,
CA). For
= example, the vector can include one or more linkers between the
purification domain
and the peptide or polypeptide. One such expression vector provides for
expression of. -
a fusion protein comprising a peptide or polypeptide of the invention and a
polynucleotide encoding 6 histidine residues preceding a thioredoxin or an
enterokinase

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
cleavage site. The histidine residues facilitate purification on IMAC
(immobilized metal
ion affinity chromatography as described in Porath, J. et at. (1992) Prot.
Exp. Purif. 3:
263-281) while the enterokinase cleavage site provides a means for purifying
the
peptide or polypeptide from the fusion protein. A discussion of vectors which
contain
5 fusion proteins is provided in Kroll, D. J. et al. (1993; DNA Cell Biol.
12:441-453).
In another aspect, the invention provides a peptide or polypeptide comprising
an
epitope-bearing portion of a polypeptide of the invention. The epitope of this
polypeptide
portion can be an immunogenic (eliciting an immune response) or antigenic
(antibody-
10 binding) epitope. These immunogenic epitopes can, be confined to a few
loci on the
molecule. It is understood that the number of immunogenic epitopes of a
protein ,
generally is less than the number of antigenic epitopes. See, for instance,
Geysen et al.,
Proc. Natl. Acad. Sci. USA 81:3998-4002 (1983).
15 As to the selection of peptides or polypeptides bearing an antigenic
epitope (i.e., that
contain a region of a protein molecule to which an antibody can bind), it is
well known in
that art that relatively short synthetic peptides that mimic part of a protein
sequence are
routinely capable of eliciting an antiserum that reacts with the partially
mimicked protein.
See, for instance, Sutcliffe, J. G., Shinnick, T. M., Green, N. and Learner,
R. A. (1983).
20 Antibodies that react with predetermined sites on proteins are described in
Science
219:660-666. Peptides capable of eliciting protein-reactive sera are
frequently
represented in the primary sequence of a protein, can be characterized by a
set of
simple chemical rules, and are confined neither to immunodominant regions of
intact
proteins (i.e., immunogenic epitopes) nor to the amino or carboxyl .terminals.
Peptides
25 that are extremely hydrophobic and those of six or fewer residues generally
are
ineffective at inducing antibodies that bind to the mimicked protein; longer,
peptides,
especially those containing proline residues, usually are effective. Sutcliffe
et al., p. 661.
Antigenic epitope-bearing peptides and polypeptides of the invention are
therefore
30 useful to raise antibodies, including monoclonal antibodies, that bind
specifically to a
polypeptide of the invention. Thus, a high proportion of hybridomas obtained
by fusion
of spleen cells from donors immunized with an antigen epitope-bearing peptide
= generally secrete antibody reactive with the native protein. Sutcliffe et
al., p. 663. The
antibodies raised by antigenic epitope-bearing peptides or polypeptides are
useful to
35 detect the mimicked protein, and antibodies to different peptides may be
used for

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
41
tracking the fate of various regions of a protein precursor which undergoes
post-
translational processing. The peptides andanti-peptide antibodies may be used
in a
variety of qualitative or quantitative assays for the mimicked protein, for
instance in
competition assays since it has been shown that even short peptides (e.g.,
about 9
amino acids) can bind and displace the larger peptides in immunoprecipitation
assays.
See, for instance, Wilson et al., Cell 37:767-778 (1984) at 777. The anti-
peptide
antibodies of the invention also are useful for purification of the mimicked
protein, for
instance, by adsorption chromatography using methods well known in the art.
Antigenic epitope-bearing peptides and polypeptides of the invention designed
according to the above guidelines preferably contain a sequence of at least
seven,
more preferably at least nine and most preferably between about 15 to about 30
amino
acids contained within the amino acid sequence of a polypeptide of the
invention.
However, peptides or polypeptides comprising a larger portion of an amino acid
sequence of a polypeptide of the invention, containing about 30 to about 50
amino
acids, or any length up to and including the entire amino acid sequence of a
polypeptide
of the invention, also are considered epitope-bearing peptides or polypeptides
of the
invention and also are useful for inducing antibodies that react with the
mimicked
protein. Preferably, the amino acid sequence of the epitope-bearing peptide is
selected
to provide substantial solubility in aqueous solvents (i.e., the sequence
includes
relatively hydrophilic residues and highly hydrophobic sequences are
preferably
avoided); and sequences containing proline residues are particularly
preferred.
The epitope-bearing peptides and polypeptides of the invention may be produced
by _
any conventional means for making peptides or polypeptides including
recombinant
means using polynucleotides of the invention. For instance, a short ,epitope-
bearing
amino acid sequence may be fused to a larger polypeptide which acts as a
carrier
during recombinant production and purification, as well as during immunization
to
produce anti-peptide antibodies. Epitope-bearing peptides also may be
synthesized=
using known methods of chemical synthesis. See, e.g., Houghten, R. A. (1985)
General
method for the rapid solid-phase synthesis of large numbers of peptides:
specificity of
antigen-antibody interaction at the level of individual amino acids. Proc.
Natl. Acad. Sci.
USA 82:5131-5135. This process is further described in U.S. Pat. No. 4,631,211
to
Houghten et al. (1986). In this procedure the individual resins for the solid-
phase
synthesis of various peptides are contained in separate solvent-permeable
packets,

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
42
=
enabling the optimal use of the many identical repetitive steps involved in
solid-phase
methods. A completely manual procedure allows 500-1000 or more syntheses to be
conducted simultaneously. Houghten et al., p. 5134
Epitope-bearing peptides and polypeptides of the invention are used to induce
antibodies according to methods well known in the art. See, for instance,
Sutcliffe et al.,
supra; Wilson et al., supra; Chow, M. et al., Proc. Natl. Acad. Sci. USA
82:910-914; and
Bittle, F. J. et al., J. Gen Virol. 66:2347-2354 (1985). Generally, animals
may be
immunized with free peptide; however, anti-peptide antibody titer may be
boosted by
coupling of the peptide to a nnacromolecular carrier, such as keyhole limpet
hemacyanin
(KLH) or tetanus toxoid. For instance, peptides containing cysteine may be
coupled to
carrier using a linker such as m-maleimidobenzoyl-N-hydroxysuccinimide ester
(MBS),
while other peptides may be coupled to carrier using a more general linking
agent such
as glutaraldehyde. Animals such as rabbits, rats and mice are immunized with
either
free or carrier-coupled peptides, for instance, by intraperitoneal -and/or
intradermal
injection of emulsions containing about 100 g peptide or carrier protein and
Freund's
adjuvant. Several booster injections may be needed, for instance, at intervals
of about
two weeks, to provide a useful titer of, anti-peptide antibody which can be
detected, for
example, by ELISA assay using free peptide adsorbed to a solid surface. The
titer of
anti-peptide antibodies in serum from an immunized animal may be increased by
= selection of anti-peptide antibodies, for instance, by adsorption to the
peptide on a solid
support and elution of the selected antibodies according to methods well known
in the
art.
Immunogenic epitope-bearing peptides of the invention, i.e., those parts of a
protein
that elicit an antibody response when the whole protein is the immunogen, are
identified
according to methods known in the art. For instance, Geysen et al., supra,
discloses a
procedure for rapid concurrent synthesis on solid supports of hundreds of
peptides of
sufficient purity to react in an enzyme-linked immunosorbent assay.
Interaction of
=_synthesized peptides with antibodies is then easily detected without
removing them
from the support. In this manner a peptide bearing an immunogenic epitope of a
desired
protein may be identified routinely by one of ordinary skill in the art For
instance, the
immunologically important epitope in the coat protein of foot-and-mouth
disease .virus
was located by Geysen et al. with a resolution of seven amino acids by
synthesis of an
.. overlapping set of all 208 possible hexapeptides covering the entire 213
amino acid

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
43
sequence of the protein. Then, a complete replacement set of peptides in which
all 20
amino acids were substituted in turn at every position within the epitope were
synthesized, and the particular amino acids conferring. specificity for the
reaction with
antibody were determined. Thus, peptide analogs of the epitope-bearing
peptides of the
invention can be made routinely by this method. U.S. Pat. No. 4,708,781 to
Geysen
(1987) further describes this method of identifying a peptide bearing an
immunogenic
epitope of a desired protein.
Further still, U.S. Pat. No. 5,194,392 to Geysen (1990) describes a general
method of
detecting or determining the sequence of monomers (amino acids or other
compounds)
which is a topological equivalent of the epitope (i.e., a "mimotopen) which is
complementary to a ,particular paratope (antigen binding site) of an antibody
of interest.
More -generally, U.S. Pat. No. 4,433,092 to Geysen (1989) describes a method
of
detecting or determining a sequence of monomer which is a topographical
equivalent of
a ligand which is complementary to the ligand binding site of a particular
receptor of
interest. Similarly, U.S. Pat. No. 5,480,971 to Houghten, R. A. et al. (1996)
on
Peralkylated Oligopeptide Mixtures discloses linear C1-C7-alkyl peralkylated
oligopeptides and sets and libraries of such peptides, as well as methods for
using such
oligopeptide sets and libraries for determining the sequence of a peralkylated
oligopeptide that preferentially binds to an acceptor molecule of interest.
Thus, non-
peptide analogs of the epitope-bearing peptides of the invention also can be
made
routinely by these methods.
As one of skill in the art will appreciate, the polypeptides of the present
invention and
the epitope-bearing fragments thereof described above can be combined with
parts of
the constant domain of irnnnunoglobulins (IgG), resulting in chimeric
polypeptides.
These fusion proteins facilitate purification and show an increased half-life
in vivo. This
has been demonstrated, e.g., for chimeric proteins consisting of the first two
domains of
the human CD4-polypeptide and various domains of the constant regions of the
heavy
or light chains of mammalian immunoglobulins (EPA 394,827; Traunecker et al.,
Nature
331:84-86 (1988)). Fusion proteins that have a disulfide-linked dimeric
structure due to
the IgG part can also be more efficient in binding and neutralizing other
molecules than
the monomeric protein or protein fragment alone (Fountoulakis et al., J
Biochem
270:3958-3964 (1995)).
=

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
44
Non-ribosomal peptide synthetases
As particular examples, the polypeptides of the invention may include non-
ribosomal
peptide synthetases. Non-ribosomal peptides are synthesized on enzymatic
thiotemplates termed non-ribosomal peptide synthetases (NRPS). The non-
ribosomal
peptides encompass a wide range of compounds having diverse activities
including, but
not limited to, immunosupressive (such as cyclosporin), surfactant (such as
surfactin),
siderophores (such as enterobactin), virulence factors (such as
yersinabactin),
antibacterial (such as penicillin and vancomycin), and anti-cancer (such as
actinomycin
and bleomycin) activities (Weber et al., Current Genomics 1994; 26:120-25;
Ehmann et
al., Proc. Nat. Acad. Sci. 2000; 97:2509-14; Gehring et al., Biochemistry
1998;
37:11637; Ka!low et al., Biochemistry 1998; 37:5947-52; Trauger et al., Proc.
Nat. Acad.
Sci. 2000; 97:3112-17; Schauweker et al., J. Bacteriology 1999; 27:2468-74;
and Shen
et al., Bioorganic Chem 1999; 27:155-71). As to particular NRPS products, see
Felnagle et al., Nonribosomal peptide synthetases involved in the production
of
medically relevant natural products, Mol. Pharm. 2008 Mar-Apr;5(2):191-211.
Non-ribosomal peptides typically range in size from 1-11 amino acids and are
produced
by a variety of microbes including cyanobacteria, actinomycetes, and fungi. In
many
cases the non-ribosomal peptides contain non-proteogenic amino acids such as
norleucine, p-alanine, omithine, etc., for which biogenesis pathways, which
are
secondary to primary metabolism, are required and are post--synthetically
modified (e.g.,
hydroxylated, methylated or acylated) by tailoring enzymes. The term
proteogenic
indicates that the amino acid can be incorporated into a protein in a cell
through well-
known metabolic pathways. The choice of including a (D)- or (L)-amino add into
a
peptide of the present invention depends, in part, on the desired
characteristics of the
peptide. For example, the incorporation of one or more (D)-amino acids can
confer
increasing stability on the peptide in vitro or in vivo. The term amino acid
equivalent
refers to compounds which depart from the structure of the naturally occurring
amino
acids, but which have substantially the structure of an amino acid, such that
they can be
substituted within a peptide that retains biological activity. Thus, for
example, amino
acid equivalents can include amino acids having side chain modifications
and/or
substitutions, and also include related organic acids, amides or the like.

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
The polynucleotide sequences required to make a NRPS and the necessary
tailoring
enzymes have been shown in all cases to be localized to the chromosome of the
producing microbe. NRPS are modular in nature, where a module may be defined
as a
segment of the NRPS necessary to catalyze the activation of a specific amino
acid and -
5 result in the incorporation of that amino acid into a non-ribosomal
peptide. A minimal
module contains three domains: (1) adenylation domains (about 60 kDa),
responsible
for selecting and activating an amino acid and transferring the aminoacyl
adenylate to a
peptidyl carrying centre; (2) thiolation domains, also referred to as peptidyl
carrier
proteins (8-10 kDa), containing a serine residue which is post-translationally
modified
10 with a 4-phosphopantetheine group (Ppant) which acts as an acceptor for
the aminoacyl
adenylate; and (3) condensation domains (50-60 kDa) which catalyze peptide
bond-
forming chain-translocating steps between an upstream peptidyl-s-Ppant and the
downstream aminoacyl-Ppant of the adjacent module (Doekel, S. and Marahiel, M.
A.
2000; Chem. Biol. 7:373-384). This minimal module for chain extension is
typically
15 repeated within a synthetase and a co-linear relationship exists between
the number of
modules present and the number of amino acids in the final product with the
order of
the modules in the synthetase determining the order of the amino acids in the
peptide.
The adenylation domain is typically about 60 kDa. The main function of this
domain is to
20 select and activate a specific amino acid as an aminoacyl adenylate. Based
on its
function, the adenylation domain regulates the sequence of the peptide being
produced.
Once charged (as an amino acyl adenylate moiety), the amino add is transferred
to a
thiolation domain (peptidyl carrying centre). The thiolation domain is also
referred to as
a peptidyl carrier protein. This domain is typically 8-10 kDa and contains a
serine
25 residue that is post-translationally modified with a 4-
phosphopantetheine group. This
group acts as an acceptor for the aminoacyl adenylate moiety on the amino
acid. A
nucleophilic reaction leads to the release of the aminoacyl adenylate and
conjugation of
the amino acid to thiolation domain via a thioester bond. The condensation
domain is
typically about 50-60 kDa in size. The main function of this domain is to
catalyze the
30 formation of a peptide bond between two amino acids. In this reaction an
upstream
tethered peptidyl group is translocated to the downstream aminoacyl-s-Ppant
and linked
to the amino acid by peptide bond formation.
This minimal module for chain extension is typically repeated within a
synthetase.
35 Additionally, and typically, a co-linear relationship exists between the
number of

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
46
modules present and the number of amino acids in the final product with the
order of
the modules in the synthetase determining the order of the amino acids in the
peptide.
This 1:1 relationship, with every amino acid in the product having one module
within the
enzyme, is referred to as the co-linearity rule. Examples have been found that
violate
this rule, and in such cases, the NRPS contains more modules than one would
expect
based on the number of amino acids incorporated in the peptide product
(Challis et al.,
Chem. Biol. 2000; 7:211-24). In some cases the minimal module also is
supplemented
with additional domains (epimerization, N- or C-methylation, or cyclization
domain), with
their position in the synthetase determining the substrate upon which they can
act. In
addition, it has been observed that NRPS contain inter-domain spacers or
linker
regions. It has been proposed that these spacers may play a critical role in
communication between domains, modules, and even entire synthetases.
There are highly conserved motifs in the Catalytic domains of peptide
synthetases
including: 10 conserved motifs in the adenylation domain; 1 conserved motif in
the
thiolation domain; 7 conserved motifs in the condensation domain; 1 conserved
motif in
the thioesterase domain; 7 conserved motifs in the epimerization domains; and
3
conserved motifs in the N-methylation domains. These are detailed in Marahiel
et al.,
Chemical Rev. 1997; 97:2651-73. In addition to modifications such as
epimerization,
methylation and cyclization during peptide synthesis, post-translational
modifications
including methylation, hydroxylation, oxidative cross-linking and
glycosylation can occur
(Walsh et al., Curr. Opin. Chem. Biol. 2001; 5:525-34).
In the present invention, the polynucleotide and polypeptide sequences for
NRPS from
M. ruminantium have been characterized (see below). For use with the present
invention, the enzymes may be tailored as needed. For example, after
production of the
core of the peptide product, the sequence may then be modified by additional
enzymes
which are herein termed tailoring enzymes. These enzymes alter the amino acids
in the
compound without altering the number or the specific amino acids present
within the
compound. Such tailoring enzymes may include, but are not limited to, arginine
cyclase,
an 0-mannosyltransferase, a phenylalanine C-methyltransferase, a first
isovaleryl
transferase, and a second isovaleryl transferase. The present invention
permits specific
changes to be made, either by site directed mutagenesis or replacement, to
genetically
modify the peptide core. The modifications may be made in a rational manner to
improve the biological activity of the peptide produced by the strain or to
direct

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
47
synthesis of compounds that are structurally related to the peptide. The
invention also
allows for the tailoring enzymes to be used for biotransformation experiments
to
produce enzymes to modify and possibly improve other useful compounds. As to
modified NRPS products, see Velkov et al., Non-ribosomal peptide synthetases
as
technological platforms for the synthesis of highly modified peptide
bioeffectors--,
Cyclosporin synthetase as a complex example, Biotechnol Annu Rev. 2003;9:151-
97.
The determination of the NRPS from M. ruminantium also enables one of ordinary
skill
in the art to clone and express the pathway into a heterologous organism. Any
organism
may be used, although preferably a bacterial strain is used. The choice of
organism is
dependent upon the needs of the skilled artisan. For example, a strain that is
amenable
to genetic manipulation may be used in order to facilitate modification and
production of
the peptide product. The present invention advantageously permits specific
changes to
be made to individual modules of NRPS, either by site directed mutagenesis or
replacement, to genetically modify the peptide core. Additionally, the NRPS
modules
can be used to modify other NRPS that direct the synthesis of other useful
peptides
through module swapping. For example, the module in NRPS that incorporates
tyrosine
into the peptide core of the product may be modified so as to incorporate a
serine in its
place.
The activity of any NRPS disclosed herein may be evaluated using any method
known
in the art. For example, specific modifications to the polypeptide sequence
may be
produced to alter the final product. Other non-limiting examples of studies
that may be
conducted with these proteins include (i) evaluation of the biological
activity of a protein
and (ii) manipulation of a synthetic pathway to alter the final product from
microbes.
Genetic manipulations and expression of the polypeptides discussed herein may
be
conducted by any method known in the art. For example, the effect of point
mutations
may be evaluated. The mutations may be produced by any method known in the
art. In
one specific method, the manipulations and protein expression may be conducted
using
a vector that comprises at least one origin of replication. The origins of
replication allow
for replication of the polynucleotide in the vector in the desired cells.
Additionally, the
vector may comprise a multiple cloning site that allows for the insertion of a
heterologous nucleic acid that may be replicated and transcribed by a host
cell. In one
particular aspect, conjugation can be used for the direct transfer of nucleic
acid from
one prokaryotic cell to another via direct contact of cells. The origin of
transfer is

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
48.
determined by a vector, so that both donor and recipient cells obtain copies
of the
vector. Transmissibility by conjugation is controlled by a set of genes in the
tra region,
which also has the ability to mobilize the transfer of chromosomes when the
origin of
transfer is integrated into them (Pansegrau et at., J. Mol. Biol., 239:623-
663, 1994; Fong
and Stanisich, J. Bact., 175:448-456, 1993).
The vector described previously may be used to assess the biological activity
of the
NRPS. The vector may be used to alter a polypeptide, either by partial or
complete
removal of the polynucleotide sequence encoding the protein, or by disruption
of that
sequence. Evaluation of the products produced when the altered polypeptide is
present
is useful in determining the functionality of the polypeptide. As discussed
above,
specific polypeptides within the biochemical pathway may be modified to assess
the
activity of the compounds produced by these altered polypeptides and to
determine
which sections of the product are important for activity and function. The
present
invention contemplates any method of altering any of the NRPS of the present
invention. More specifically, the invention contemplates any method that would
insert
amino acids, delete amino acids or replace amino acids in the polypeptides of
the
invention. Additionally, a whole domain in a module in a NRPS may be replaced.
Therefore, for example, the acylation domain that incorporates tyrosine into
the final
product may be replaced with a domain that incorporates serine. The
modifications may
be performed at the nucleic acid level. These modifications may be performed
by
standard techniques and are well known within the art. Upon production of the
polynucleotide encoding the modified polypeptide, the amino acid sequence can
be
expressed in a host cell. Then the host cell can be cultured under conditions
that permit
production of a product of the altered pathway. Once the product is isolated,
the activity
of the product may be assessed using any method known in the art. The activity
can be
compared to the product of the non-modified biosynthetic pathway and to
products
produced by other modifications. Correlations may be drawn between specific
alterations and activity. For example, it may be determined that an active
residue at a
specific position may increase activity. These types of correlations will
allow one of
ordinary skill to determine the most preferred product structure for specified
activity. As
to modification techniques for NRPS, see Durfahrt et al., Functional and
structural basis
for targeted modification of non-ribosomal peptide synthetases, Ernst Schering
Res
Found Workshop. 2005;(51):79-106.
=

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
49
The present invention also contemplates a method for using an intergeneric
vector to
manipulate, modify, or isolate a protein involved in the synthesis of a
specific product.
For example, the vector of the present invention may be used to alter an
enzyme which
is involved in incorporation of an alanine residue into a peptide, so that a
tyrosine
residue is incorporated instead. The effect of this modification on peptide
function may
be then be evaluated for biological efficacy. In the above example,
modifications to the
enzyme may include, but are not limited to, removal of amino acids and/or
sequences
that specifically recognize alanine and/or incorporation of amino acids and/or
sequences that specifically recognize tyrosine. Therefore, in general terms,
the vector
of the present invention may be used to alter a gene sequence by insertion of
nucleic
acid sequences, deletion of nucleic acid sequences, or alteration of specific
bases
within a nucleic acid sequence to alter the sequence of a polypeptide of
interest;
. thereby producing a modified protein of interest. Preferably, the
polypeptide of interest
is involved in the synthesis of a compound of interest. The method of
modifying a
protein may comprise (i) transfecting a first microbial cell with the vector
of the present
invention, (ii) culturing the first microbial cell under conditions that allow
for replication of
the vector, (iii) conjugating the first microbial cell with a second microbial
cell under
conditions that allow for the direct transfer of the vector from the first
microbial cell to
the second microbial cell, and (iv) isolating the second microbial cell
transformed with
the vector. Other method of vector transfer are also contemplated and
disclosed herein.
=
Antibodies and vaccines
The antibodies of the invention may be produced using methods which are
generally
known in the art. In particular, purified peptides, polypeptides, or
polynucleotides may
be used to produce antibodies in accordance with known methods. Such
antibodies
may include, but are not limited to, polyclonal, monoclonal, chimeric, and
single chain
antibodies, Fab fragments, and fragments produced by a Fab expression library.
Neutralizing antibodies, (i.e., those which inhibit function) are especially
preferred for
use with vaccines.
For the production of antibodies, various hosts including goats, rabbits,
rats, mice,
humans, and others, may be immunized by injection with a peptide, polypeptide,
polynucleotide, or any fragment thereof which has immunogenic properties.
Depending
on the host species, various adjuvants may be used to increase immunological

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
response. Such adjuvants include, but are not limited to, Freund's, mineral
gels such as
aluminium hydroxide, and surface active substances such as lysolecithin,
pluronic
polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanin, and
dinitrophenol. Among adjuvants used in humans, BCG (bacilli Calmette-Guerin)
and
5 Corynebacterium parvum are especially preferable.
,
It is preferred that the peptides, polypeptides, or fragments used to induce
antibodies
have an amino acid sequence comprising at least five amino acids and more
preferably
at least 10 amino acids. It is also preferable that they are identical to a
portion of the
10 amino acid sequence of the natural protein, and they may contain the
entire amino acid
sequence of a small, naturally occurring molecule. Short stretches of amino
acids may
be fused with those of another protein such as keyhole limpet hemocyanin and
antibody
produced against the chimeric molecule.
15 Monoclonal antibodies may be prepared using any technique which provides
for the
production of antibody molecules by continuous cell lines in culture. These
include, but
are not limited to, the hybridoma technique, the human B-cell hybridoma
technique, and
the EBV-hybridoma technique (Kohler, G. et al. (1975) Nature 256A95-497;
Kozbor, D.
et at. (1985) J. lmmunol. Methods 81:31-42; Cote, R. J. et at. (1983) Proc.
Natl. Acad.
20 Sci. 80:2026-2030; Cole, S. P. et al. (1984) Mol. Cell Biol. 62:109-
120).
In addition, techniques developed for the production of "chimeric antibodies",
e.g., the
combining of mouse antibody genes and human antibody genes to obtain a
molecule
with appropriate antigen specificity and biological activity can be used
(Morrison, S. L.
25 et at. (1984) Proc. Natl. Acad. Sci. 81:6851-6855; Neuberger, M.S. et
al. (1984) Nature
312:604-608; Takeda, S. et al. (1985) Nature 314:452-454). Alternatively,
techniques
described for the production of single chain antibodies may be adapted, using
methods
known in the art, to produce specific single chain antibodies. Antibodies with
related
specificity, but of distinct idiotypic composition, may be generated by chain
shuffling
30 from random combinatorial immunoglobin libraries (Burton D. R. (1991)
Proc. Natl.
Acad. Sci. 88:11120-3).
Those of skill in the art to which the invention relates will appreciate the
terms
"diabodies" and "triabodies". These are molecules which comprise a heavy chain
35 variable domain (VH) connected to a light chain variable domain (VL) by
a short peptide

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
51
linker that is too short to allow pairing between the two domains on the same
chain.
This promotes pairing with the complementary domains of one or more other
chains
and encourages the formation of dimeric or trimeric molecules with two or more
functional antigen binding sites. The resulting antibody molecules may be
monospecific
or multispecific (e.g., bispecific in the case of diabodies). Such antibody
molecules may
be created from two or more antibodies using methodology standard in the art
to which
the invention relates; for example, as described by Todorovska et al. (Design
and
application of diabodies, triabodies and tetrabodies for cancer targeting. J.
lmmunol.
Methods. 2001 Feb 1;248(1-2):47-66).
Antibodies may also be produced by inducing in vivo production in the
lymphocyte
population or by screening immunoglobulin libraries or panels of highly
specific binding
reagents as disclosed in the literature (Orlandi, R. et al. (1989) Proc. Natl.
Acad. Sci.
86:3833-3837; Winter, G. et al. (1991) Nature 349:293-299).
Antibody fragments which contain specific binding sites may also be generated.
For
example, such fragments include, but are not limited to, the F(alp')2
fragments which can
be produced by pepsin digestion of the antibody molecule and the Fab fragments
which
can be generated by reducing the disulfide bridges of the F(a131)2 fragments.
Alternatively, Fab expression libraries may 6e constructed to allow rapid and
easy
identification of monoclonal Fab fragments with the desired specificity (Huse,
W. D. et
al. (1989) Science 254:1275-1281).
Various immunoassays may be used for screening to identify antibodies having
binding
specificity. Numerous protocols for competitive binding or immunoradiometric
assays
using either polyclonal or monoclonal antibodies with established
specificities are well
known in the art. Such immunoassays typically involve the measurement of
complex
formation between a peptide, polypeptide, or polynucleotide and its specific
antibody. A
two-site, monoclonal-based immunoassay utilizing monoclonal antibodies
reactive to
two non-interfering epitopes is preferred, but a competitive binding assay may
also be
employed (Maddox, supra).
The antibodies described herein have the ability to target and/or inhibit
cells and are
also useful as carrier molecules for the delivery of additional inhibitory
molecules into
microbial cells. The chemistry for coupling compounds to amino acids is well
developed

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
52
and a number of different molecule types could be linked to the antibodies.
The most
common coupling methods rely on the presence of free amino (alpha-amino or
Lys),
sufhydryl (Cys), or carboxylic acid groups (Asp, Glu, or alpha-carboxyl).
Coupling
methods can be used to link the antibody to the cell inhibitor via the carboxy-
or amino-
terminal residue. In some cases, a sequence includes multiple residues that
may react
with the chosen chemistry. This can be used to produce multimers, comprising
more
than one cell inhibitor. Alternatively, the antibody can be shortened or
chosen so that
reactive residues are localized at either the amino or the carboxyl terminus
of the
sequence.
For example, a reporter molecule such as fluorescein can be specifically
incorporated at
a lysine residue (Ono et al., 1997) using N-a-Fmoc-Ne-1-(4,4-dimethy1-2,6
dioxocyclohex-1-ylidene-3-methylbuty1)-L-lysine during polypeptide synthesis.
Following
synthesis, 5- and 6-carboxyfluorescein succinimidyl esters can be coupled
after 4,4-
dimethy1-2,6 dioxocyclohex-1-ylidene is removed by treatment with hydrazine.
Therefore coupling of an inhibitory molecule to the antibody can be
accomplished by
inclusion of a lysine residue to the polypeptide sequence, then reaction with
a suitably
derivatised cell inhibitor.
EDC (1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride) or the
carbodiimide coupling method can also be used. Carbodiimides can activate the
side
chain carboxylic groups of aspartic and glutamic acid as well as the carboxyl-
terminal
group to make them reactive sites for coupling with primary amines. The
activated
antibody is mixed with the cell inhibitor to produce the final conjugate. If
the cell inhibitor
is activated first, the EDC method will couple the cell inhibitor through the
N-terminal
alpha amine and possibly through the amine in the side-chain of Lys, if
'present in the
sequence.
m-Maleimidobenzoyl-N-hydroxysuccinimide ester (MBS) is a heterobifunctional
reagent
that can be used to link an antibody to cell inhibitors via cysteines. The
coupling takes
place with the thiol group of cysteine residues. If the chosen sequence does
not contain
Cys it is common to place a Cys residue at the N- or C-terminus to obtain
highly
controlled linking of the antibody to the cell inhibitor. For synthesis
purposes, it may be
helpful for the cysteine to be placed at the N-terminus of the antibody. MBS
is
particularly suited for use with the present invention.

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
53
Glutaraldehyde can be used as a bifunctional coupling reagent that links two
compounds through their amino groups. Glutaraldehyde provides a highly
flexible
spacer between the antibody and cell inhibitor for favorable presentation.
Glutaraldehyde is a very reactive compound and will react with Cys, Tyr, and
His to a
limited extent. The glutaraldehyde coupling method is particularly useful when
a
polypeptide contains only "a single free amino group at its amino terminus. If
the
antibody contains more than one free amino group, large multimeric complexes
can be
formed.
In one aspect, the antibodies of the invention can be fused (e.g., by in-frame
cloning) or
linked (e.g., by chemical coupling) to cell inhibitors such as antimicrobial
agents.
Included among these are antimicrobial peptides, for example,
bactericidal/permeability-
increasing protein, cationic antimicrobial proteins, lysozymes, lactoferrins,
and
cathelicidins (e.g., from neutrophils; see, e.g., Hancock and Chapple, 1999,
Antinnicrob.
Agents Chemother.43:1317-1323; Ganz and Lehrer, 1997, Curr. Opin. Hematol.
4:53-
58; Hancock et al., 1995, Adv. Microb. Physiol. 37:135-175). Antimicrobial
peptides
further include defensins (e.g., from epithelial cells or neutrophils) and
platelet
microbiocidal proteins (see, e.g., Hancock and Chapple, 1999, Antimicrob.
Agents
Chemother.43:1317-1323). Additional antimicrobial peptides include, but are
not limited
to, gramicidin S, bacitracin, polymyxin B, tachyplesin, bactenecin (e.g.,
cattle
bactenecin), ranalexin, cecropin A, indolicidin (e.g., cattle indolicidin),
and nisin (e.g.,
bacterial nisin).
Also included as antimicrobial agents are ionophores, which facilitate
transmission of an
ion, (such as sodium), across a lipid barrier such as a cell membrane. Two
ionophore
compounds particularly suited to this invention are the RUMENSINTm (Eli Lilly)
and
Lasalocid (Hoffman LaRoche). Other ionophores include, but are not limited to,
salinomycin, avoparcin, aridcin, and actaplanin. Other antimicrobial agents
include
MonensinTm and azithromycin, metronidazole, streptomycin, kanamycin, and
penicillin,
as well as, generally, 11-lactams, aminoglycosides, macrolides,
chloramphenicol,
novobiocin, rifampin, and fluoroquinolones (see, e.g., Horn et al., 2003,
Applied
Environ. Microbiol. 69:74-83; Eckburg et al., 2003, Infection Immunity 71:591-
596;
Gijzen et al., 1991, Applied Environ. Microbiol. 57:1630-1634; Bonelo et al.,
1984,

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
54
FEMS Microbiol. Lett. 21:341-345; Huser et al., 1982, Arch. Microbiol. 132:1-
9; Hilpert
et al., 1981, Zentbl. Bakteriol. Mikrobiol. Hyg. 1 Abt Orig. C 2:21-31).
Particularly useful inhibitors are compounds that block or interfere with
methanogenesis, including bromoethanesulphonic acid, e.g., 2-
bromoethanesulphonic
acid (BES) or a salt thereof, for example, a sodium salt. Sodium molybdate
(Mo) is an
inhibitor of sulfate reduction, and can be used with bromoethanesulphonic
acid. Other
anti-methanogenesis compounds include, but are not limited to, nitrate,
formate, methyl
fluoride, chloroform, chloral hydrate, sodium sulphite, ethylene and
unsaturated
hydrocarbons, acetylene, fatty acids such as linoleic and cis-oleic acid,
saturated fatty
acids such as behenic and stearic acid, and, also ,Iumazine (e.g., 2,4-
pteridinedione).
Additional compounds include 3-bromopropanesulphonate (BPS), propynoic acid,
and
ethyl 2-butynoate.
Further included as antimicrobial agents are lytic enzymes, including phage
lysozyme,
endolysin, lysozyme, lysin, phage lysin, muralysin, murannidase, and
virolysin. Useful
enzymes exhibit the ability to hydrolyse specific bonds in the bacterial cell
wall.
Particular lytic enzymes include, but are not limited to, glucosaminidases,
which
hydrolyse the glycosidic bonds between the amino sugars (e.g., N-acetylmuramic
acid
and N-acetylglucosannine) of the peptidoglycan, amidases, which cleave the N-
acetylmuramoyl-L-alanine amide linkage between the glycan strand and the cross-
linking peptide, and endopeptidases, which hydrolyse the interpeptide linkage
(e.g.,
cysteine endopeptidases) and endoisopeptidases that attack pseudomurein of
methanogens from the family Methanobacteriaceae.
Additionally, PNAs are included as antimicrobial agents. PNAs are peptide-
nucleic acid
hybrids in which the phosphate backbone has been replaced by an achiral and
neutral
backbone made from N-(2-aminoethyl)-glycine units (see, e.g., Eurekah
Bioscience
Collection. PNA and Oligonucleotide Inhibitors of Human Telomerase. G. Gavory
and S.
Balasubramanian, Landes Bioscience, 2003). The bases A, G, T, C are attached
to the
amino nitrogen on the backbone via methylenecarbonyl linkages (P.E. Nielsen et
al.,
Science 1991. 254: 1497-1500; M. Egholm et al., Nature 1993. 365: 566-568).
PNAs
bind complementary sequences with high specificity, and higher affinity
relative to
analogous DNA or RNA (M. Egholm et al., supra). PNA/DNA or PNA/RNA hybrids
also
exhibit higher thermal stability compared to the corresponding DNA/DNA or
DNA/RNA

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
duplexes (M. Egholm et al., supra). PNAs also possess high chemical and
biological
stability, due to the unnatural amide backbone that is not recognized by
nucleases Or
proteases (V. Demidov et al., Biochem Pharmacol 1994. 48: 1310-1313).
Typically,
PNAs are at least 5 bases in length, and include a terminal lysine. PNAs may
be
= 5 pegylated to further extend their lifespan (Nielsen, P. E. et al.
(1993) Anticancer Drug
Des. 8:53-63).
In one particular aspect, the antibodies of the invention can be fused or
linked to other
antibodies or fragments thereof. The added antibodies or antibody fragments
can be
10 directed to microbial cells, or particularly methanogen cells, or one or
more cell
components. For example, cell surface proteins, e.g., extracellular receptors,
can be
targeted. In certain aspects, the antibodies or antibody fragments can be
engineered
with sequences that are specifically expressed in subjects, for example, human
or
ruminant .sequences. Also included are chimeric antibodies, for example,
monoclonal
15 antibodies or fragments thereof that are specific to more than one
source, e.g., one or
more mouse, human, or ruminant sequences. Further included are camelid
antibodies
or nanobodies.
The antibodies of the invention find particular use in targeting a microbial
cell, in
20 particular, a methanogen cell. In certain aspects, the antibodies can be
used to
associate with or bind to the cell wall or membrane and/or inhibit growth or
replication of
the cell. As such, the antibodies can be used for transient or extended
attachment to the
cell, or to mediate sequestration or engulfment of the cell, and/or lysis. To
effect
targeting, the microbial cell can be contacted with an antibody as isolated
from a host
25 organism, or -produced by expression vectors and/or host cells, or
synthetic or semi-
synthetic chemistry as described in detail herein. Alternately, the antibodies
can be
produced by the host organism itself in response to the administration or the
peptides,
polypeptides, or polynucleotides disclosed herein. It is understood that the
antibodies of
the invention, as well as the corresponding polynucleotides, expression
vectors, host
30 .. cells, peptides, and polypeptides, can be used to target various
microbes, for example,
Methanobrevibacter ruminantium, which is the primary methanogen in ruminants,
and
Methanobrevibacter smithii, which is the primary methanogen in humans. In
particular
aspects, the antibodies, or corresponding polynucleotides, expression vectors,
host
cells, peptides, or polypeptides, are delivered to subjects as a composition
described in
35 detail herein, for example, through use of a slow-release ruminal
device.

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
56
In various aspects, the agents of the invention (e.g., one or more peptides,
polypeptides, polynucleotides, and antibodies) can be included in a
composition, for
example, a pharmaceutical composition, and especially a vaccine composition.
The
composition comprises, for example: a) an isolated peptide or alteration,
fragment,
variant, or derivative thereof; b) an isolated polypeptide, or an alteration,
fragment,
variant, or derivative thereof; c) an isolated polynucleotide, or an
alteration, fragment,
variant, or derivative thereof; d) an expression vector comprising this
polynucleotide; e)
a host cell comprising this expression vector; or (f) an antibody, or an
alteration,
10= fragment, variant, or derivative thereof. The compositions of the
invention can be
specifically packaged as part of kits for targeting, and/or. inhibiting
microbial cells,
especially methanogen cells, in accordance with the disclosed methods. The
kits
comprise at least one composition as set out herein and instructions for use
in targeting
cells or inhibiting cell growth or replication, for methanogens or other
microbes.
For vaccines, a number of approaches can be used to increase antigen
immunogenicity, for example, by use of antigen particles; antigen polymers and
polymerization; emulsifying agents; microencapsulation of antigens; killed
bacteria and
bacterial products; chemical adjuvants and cytokines; and agents for targeting
antigens
to antigen presenting cells (reviewed in Paul, Fundamental Immunology, 1999,
Lippincott-Raven Publishers, New York, NY, p. 1392-1405).
To render antigens particulate, alum precipitation can be used. With the use
of
aluminium hydroxide or aluminium phosphate, the antigen in question becomes
incorporated into an insoluble, gel-like precipitate or else is bound to
preformed gel by
electrostatic interactions. Antigens can be subjected to mild heat
aggregation. Antigens
exhibiting self-assembly can also be used. Liposomes, virosomes, and
immunostaining
complexes (ISCOMs) are also useful for forming particulates.
To promote polymerization, nonionic block copolymers can be used as additives
to
adjuvants, e.g., polymers or polyoxypropylene and polyoxyethylene, with which
antigen
can be associated. These are found as components of complex adjuvant
formulations
by both Syntex (SAF-1, Syntex Adjuvant Formulation-1) and Ribi Chemical Co.
Carbohydrate polymers of mannose (e.g., mannan) or of 131-3 glucose (e.g.,
glucan)
can be used in similar fashion (Okawa Y, Howard CR, Steward MW. Production of
anti-

57
peptide antibody in mice following immunization of mice with peptides
conjugated to
merman. J Immunol Methods 1992;142:127-131; Ohta M, Kido N, Hasegawa T, et al.
Contribution of the mannan side chains to the adjuvant action of
lipopolysaccharides.
Immunology 1987;60:503-507).
Various agents can be used for emulsification, including water-in-oil
emulsions, such as
Freund's adjuvants (e.g., Freund's incomplete adjuvant), or other mixtures
comprising
tiny droplets of water stabilized by a surfactant such as mannide monooleate
in a
continuous phase of mineral oil or other oils, such as squalane. An
alternative approach
is to use oil-in-water emulsions, such as MF5963 (Chiron), or other mixtures
comprising
TM
oil droplets of squalene and a mixture of emulsifying agents TVVEEN80 and
SPAN85,
and chemical innmunomodulators such as derivatives or muramyl dipeptide, e.g.,
muramyl tripeptide-phosphatidyl ethanolamine (MTP-PE) (Valensi J-PM, Carlson
JR,
Van Nest GA. Systemic cytokine profiles in Balb/c mice immunized with
trivalent
influenza vaccine containing MF59 oil emulsion and other advanced adjuvants. J
Immunol 1994;153:4029-4039). Small amounts of polysorbate 80 and sorbitan
trioleate
can also be used in the mixtures. As another example, SAF-165 (Syntex) can be
used,
or other oil-in-water mixtures comprising Pluronic L121, squalene, and
TVVEEN80.
Microcapsules, in particular, biodegradable microcapsules, can be used to
prepare
controlled-release vaccines (Chang TMS. Biodegradable, semi-permeable
microcapsules containing enzymes hormones, vaccines and other biologicals. J
Bioeng
1976;1:25-32; Langer R. Polymers for the sustained release of macromolecules:
their
use in a single step method of immunization. Methods Enzymol 1981;73:57-75).
Cyanoacrylates are another form of biodegradable polymer. For example,
poly(buty1-2-
cyanoacrylate) can be used as an adjuvant for oral immunization (O'Hagan DT,
Palin
KJ, Davis SS. Poly (butyl-2-oyanoacrylate) particles as adjuvants for oral
immunization.
Vaccine 1989;7:213-216). Microcapsules are useful for the mucosal
administration of
vaccines. Particles of very small size (nanoparticles) are particularly
suitable. Digestion
in the stomach can be countered by enteric coated polymers, and coating with
substances that increase intestinal absorption, as needed.
Various bacteria, other than killed M. tuberculosis, can be used as adjuvants.
Where the
killed bacterial preparation is itself highly antigenic, the adjuvant
properties extend to
the co-administered antigen. Useful organisms include Bordetella pertussis,
CA 2772224 2019-03-25

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
58
Corynebacterium parvum, and Nippostrongylus brasiliensis. Peptide and lipid
components of bacteria can also be used. Exemplary components include
acetylmuramyl-L-alanyl-D-isoglutamine, or murannyl dipeptide (MDP) (Ellouz F,
Adam
A, Ciorbaru R, Lederer E. Minimal structural requirements for adjuvant
activity of
bacterial peptidoglycans. Biochem Biophys Res Commun 1974;59:1317-1325), MDP
(murabutide) (Chedid L, Parant MA,. Audibert FM, et al. Biological activity of
a new
synthetic murannyl dipeptide devoid of pyrogenicity. Infect Immun 1982;35:417-
424),
threonyl MDP (Allison AC, Byars NE. An adjuvant formulation that selectively
elicits the
formation of antibodies of protective isotypes and cell-mediated immunity. J
Immunol
Methods 1986;95157-168), and MTP-PE. Lipid adjuvants can comprise LPS
endotoxins of gram-negative bacteria, such as Escherichia, Salmonella, and
Pseudomonas. In certain approaches, the lipid A structure can be chemically
modified
to lower toxicity but retain adjuvanticity, e.g., as for monophosphoryl lipid
A (MPL)
(Johnson AG, Tomai M, Solem L, Beck L, Ribi E. Characterization of non-toxic
monophosphoryl lipid. Rev Infect Dis 1987;9:S512).
Various chemicals can be used as adjuvants, including polynucleotides, such as
poly-
I:C and poly-A:U, vitamin 03, dextran sulphate, inulin, dimethyl dioctadecyl
ammonium
bromide (DDA), avridine, carbohydrate polymers similar to mannan, and
trehalose
dimycolate (Morein B, Lovgren-Bengtsson K, Cox J. Modern adjuvants: functional
aspects. In: Kaufmann SHE, ed. Concepts in vaccine development. Berlin: Walter
de
Gruyter, 1996:243-263). Also included are polyphosphazines (initially
introduced as
slow release-promoting agents) and a Leishmania protein, LelF. Cytokines can
also be
used as adjuvants, for example, IL-2, IL-4, IL-6, IL-10, GM-CSF, and IFN-g.
For targeting antigen presenting cells, C3d .domains, Fc domains, and CTB
domains
can be used (Dempsey PW, Allison MED, Akkaraju S, Goodnow CC, Fearon DT. C3d
of complement as a molecular adjuvant: bridging innate and acquired immunity.
Science 1996;271:348-350; Sun J-B, Holmgren J, Czerkinsky C. Cholera toxin B
subunit: an efficient transmucosal carrier-delivery system for induction of
peripheral
immunological tolerance. Proc Natl Acad Sci USA 1994;91:10795-10799; Sun J-B,
Rask C, Olsson T, Holmgren J, Czerkinsky C. Treatment of experimental
autoinnmune
encephalomyelitis by feeding myelin basic protein conjugated to cholera toxin
B subunit.
Proc Natl Acad Sci USA 1996;93:7196-7201).

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
59
Specific adjuvants for mucosal delivery, e.g., CT, LT, and Fragment C of
tetanus toxin,
can also be used (Elson CJ, Ea!ding W. Generalized systemic and mucosal
immunity in
mice after mucosal stimulation with cholera toxin. J Immunol 1984;132:2736-
2743;
Holmgren J, Lycke N, Czerkinsky C. Cholera toxin and cholera B subunit as oral-
mucosal adjuvant and antigen vector systems. Vaccine 1993;11:1179-1184;
Clements
JD, Hartzog NM, Lyon FL. Adjuvant activity of Escherichia colt heat-labile
enterotoxin
and effect on the induction of oral tolerance in mice to unrelated protein
antigens.
Vaccine 1988;6:269-277 Gomez-Duarte OG, Galen J, Chatfield SN, Rappuoli R,
Eidels L, Levine MM. Expression of fragment C of tetanus toxin fused to a
carboxyl-
terminal fragment of diphtheria toxin in Salmonella typhi CVD 908 vaccine
strain.
Vaccine 1995;13:1596-1602).
Therapeutics and diagnostics
The peptides, polypeptides, polynucleotides, and antibodies of the present
invention are
considered to have health benefits. In particular aspects, vaccines that
target
methanogens can be used to restore energy to the subject that is normally lost
as
methane. The invention therefore relates to a pharmaceutical composition
(especially a
vaccine composition) in conjunction with a pharmaceutically acceptable
carrier, for use
with any of the methods discussed above. Such pharmaceutical compositions may
comprise a peptide, polypeptide, or antibody in combination with a cell
inhibitor.
Alternatively, the pharmaceutical compositions may comprise a polynucleotide,
expression vector, or host cell as described in detail herein. The
compositions may be
administered alone or in combination with at least one other agent, such as
stabilizing
compound, which may be administered in any sterile, biocompatible
pharmaceutical
carrier, including, but not limited to, saline, buffered saline, dextrose, and
water. The
compositions may be administered to a subject alone, or in combination with
other
agents, drugs (e.g., antimicrobial drugs), or hormones.
In addition to the active ingredients, these pharmaceutical compositions may
contain
suitable pharmaceutically acceptable carriers comprising excipients and
auxiliaries
which facilitate processing of the active compounds into preparations which
can be
=used pharmaceutically. Further details on techniques for formulation and
administration
may be found in the latest edition of Remington's Pharmaceutical Sciences
(Maack
Publishing Co., Easton, PA). The pharmaceutical compositions utilized in this
invention

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
may be administered by any number of routes including, but not limited to,
oral,
intravenous, intramuscular, intra-arterial, intramedullary, intrathecal,
intraventricular,
_
transdermal, subcutaneous, intraperitoneal, intranasal, enteral, topical,
sublingual, or
rectal means.
5
Pharmaceutical compositions for oral administration can be formulated using
pharmaceutically acceptable carriers well known in the art in dosages suitable
for oral
administration. Such carriers enable the pharmaceutical compositions to be
formulated
as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries,
suspensions, and the
10 like, for ingestion by the subject. Pharmaceutical preparations for
oral use can be
obtained through combination of active compounds with solid excipient,
optionally
grinding a resulting mixture, and processing the mixture of granules, after
adding
suitable auxiliaries, if desired, to obtain tablets or dragee cores. Suitable
excipients are
carbohydrate or protein fillers, such as sugars, including lactose, sucrose,
mannitol, or
15 sorbitol; starch from corn, wheat, rice, potato, or other plants;
cellulose, such as methyl
cellulose, hydroxypropylmethyl-cellulose, or sodium carboxymethylcellulose;
gums
including arabic and tragacanth; and proteins such as gelatin and collagen. If
desired,
disintegrating or solubilising agents may be added, such as the crosslinked
polyvinyl
pyrrolidone, agar, alginic acid, or a salt thereof, such as sodium alginate.
Pharmaceutical preparations which can be used orally include push-fit capsules
made
of gelatin, as well as soft, sealed capsules made of gelatin and a coating,
such as
glycerol or sorbitol. Push-fit capsules can contain active ingredients mixed
with a filler or
binders, such as lactose or starches, lubricants, such as talc or magnesium
stearate,
and, optionally, stabilizers. In soft capsules, the active compounds may be
dissolved or
suspended in suitable liquids, such as fatty oils, liquid, or liquid
polyethylene glycol with
or without stabilizers. Dragee cores may be used in conjunction with suitable
coatings,
such as concentrated sugar solutions, which may also contain gum arabic, talc,
polyvinylpyrrolidone, carbopol gel, polyethylene glycol, and/or titanium
dioxide, lacquer
solutions, and suitable organic solvents or solvent mixtures. Dyestuffs or
pigments may
be added to the tablets or dragee coatings for product identification or to
characterize
the quantity of active compound, i.e., dosage.
Pharmaceutical formulations suitable for parenteral administration may be
formulated in
aqueous solutions, preferably in physiologically compatible buffers such as
Hanks'

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
61
solution, Ringer's solution, or physiologically buffered saline. Aqueous
injection
suspensions may contain substances which increase the viscosity of the
suspension,
such as sodium carboxymethyl cellulose, sorbitol, or dextran. Additionally,
suspensions
of the active compounds may be prepared as appropriate oily injection
suspensions.
Suitable lipophilic solvents or vehicles include fatty oils such as sesame
oil, or synthetic
fatty acid esters, such as ethyl oleate or triglycerides, or liposomes. Non-
lipid
polycationic amino polymers may also be used for delivery. Optionally, the
suspension
may also contain suitable stabilizers or agents which increase the solubility
of the
compounds to allow for the preparation of highly concentrated solutions. For
topical or
nasal administration, penetrants appropriate to the particular barrier to be
permeated
are used in the formulation. Such penetrants are generally known in the art.
The pharmaceutical compositions of the present invention may be manufactured
in a
manner that is known in the art, e.g., by means of conventional mixing,
dissolving,
granulating, dragee-making, levigating, emulsifying, encapsulating,
entrapping, or
lyophilizing processes. The pharmaceutical composition may be provided as a
salt and
can be formed with many acids, including but not limited to, hydrochloric,
sulfuric,
acetic, lactic, tartaric, malic, succinic, etc. Salts tend to be more soluble
in aqueous or
other protonic solvents than are the corresponding free base forms. In other
cases, the
preferred preparation may be a lyophilized powder which may contain any or all
of the
following: 1-50 mM histidine, 0.1%-2% sucrose, and 2-7% mannitol, at a pH
range of
4.5 to 5.5, that is combined with buffer prior to use. After pharmaceutical
compositions
have been prepared, they can be placed in an appropriate container and labeled
for
treatment of an indicated condition. For administration of a composition of
the invention,
such labeling would include amount, frequency, and method of administration.
Pharmaceutical compositions suitable for use in the invention include
compositions
wherein the active ingredients are contained in an effective amount to achieve
the
intended purpose. For any compound, the therapeutically effective dose can be
estimated initially either in cell assays, e.g., in microbial cells, or in
particular, in
methanogen cells, or in animal models, usually mice, rabbits, dogs, or pigs,
or in
ruminant species such as sheep, cattle, deer, and goats. The animal model may
also be
used to determine the appropriate concentration range and route of
administration.
Such information can then be used to determine useful doses and routes for
administration. Normal dosage amounts may vary from 0.1 to 100,000 micrograms,
up

CA 2772224 2017-03-13
62 =
to a total dose of about 1 g, depending upon the route of administration.
Guidance as to
particular dosages and methods of delivery is provided in the literature and
generally
available to practitioners in the art. Those skilled in the art will employ
different
formulations for polynucleotides than for polypeptides. Similarly, delivery of
peptides, or
polypeptides, polynudeotides, or = antibodies will be specific to particular
cells,
conditions, locations, etc.
The exact dosage will be determined by the practitioner, in light of factors
related to the
subject that requires treatment. Dosage and administration are adjusted to
provide
sufficient levels of the active agent or to maintain the desired effect.
Factors which may
be taken into account include the severity of the disease state, general
health of the
subject, age, weight, and gender, diet, time, and frequency of administration,
drug
= combination(s), reaction sensitivities, and tolerance/response to
therapy. Long-acting
pharmaceutical compositions may be administered every 3 to 4 days, every week,
or
. 15 once every two weeks depending on half-life and clearance rate of the
particular
formulation. The compositions can be co-administered with one or more
additional anti-
microbial agents, .including anti-methanogenesis
compounds (e.g.,
bromoethanesulphonic acid), antibodies and antibody fragments, lytic enzymes,
peptide
nucleic acids, antimicrobial peptides, and other antibiotics as described in
detail herein.
Co-administration can be simultaneous or sequential, or can alternate with
repeated =
= administration.
Particularly useful for the compositions of the invention (e.g.,
pharmaceutical =
compositions) are= slow release formulas or mechanisms. For example, intra-
ruminal
devices include, but are not limited to, Time Capsulew Bolus range by Agri-
Feeds Ltd.,
New Zealand, originally developed within AgResearch Ltd., New Zealand, as
disclosed
in WO 95/19763 and NZ 278977, and CAPTEC by Nufarm Health & Sciences, a
division of Nufarm Ltd., Auckland, New Zealand, as disclosed in AU 35908178,
PCT/AU81/100082, and Laby et al., 1984, Can. J. Anim. ScL 64 (Suppl.), 337-8.
As a particular example, the device can
include a spring and plunger which force the composition against a hole in the
end of a
barrel.
As a further embodiment, the invention relates to a composition for a water
supplement,
e.g., drenching composition, or food supplement, e.g., ruminant feed
component, for

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
63
use with any of the methods discussed above. In particular aspects, the food
supplement comprises at least one vegetable material that is edible, and a
peptide or
polypeptide of the invention. Alternatively, the food supplement comprises at
least one
vegetable material that is edible, and a polypeptide or peptide, or a
polynucleotide
encoding a peptide or polypeptide disclosed herein, for example, as an
expression
vector or host cell comprising the expression vector. In particular, the
composition
further includes a cell inhibitor, as fused or linked to the resultant
sequence. The
preferred vegetable material include any one of hay, grass, grain, or meal,
for example,
legume hay, grass hay, corn silage, grass silage, legume silage, corn grain,
oats,
barley, distillers grain, brewers grain, soy bean meal, and cotton seed meal.
In
particular, grass silage is useful as a food composition for ruminants. The
plant material
can be genetically modified to contain one or more components of the
invention, e.g.,
one or more polypeptides or peptides, polynucleotides, or vectors.
In another embodiment, antibodies which specifically bind the peptides,
polypeptides, or
polynucleotides of the invention may be used to determine the presence of
microbes,
especially methanogens, or in assays to monitor levels of such microbes. The
antibodies useful for diagnostic purposes may be prepared in the same manner
as
those described above. Diagnostic assays include methods which utilize the
antibody
and a label to detect a peptide or polypeptide in human body fluids or
extracts of cells or
tissues. The antibodies may be used with or without modification, and may be
labeled
by joining them, either covalently or non-covalently, with a reporter
molecule. A wide
variety of reporter molecules which are known in the art may be used, several
of which
are described above.
A variety of protocols for measuring levels of a peptide, polypeptide, or
polynucleotide
are known in the art (e.g., ELISA, RIA, and FACS), and provide a basis for
diagnosing
the presence or levels of a microbe, especially a methanogen. Normal or
standard
levels established by combining body fluids or cell extracts taken from normal
subjects,
e.g., normal humans or ruminants, with the antibody under conditions suitable
for
complex formation. The amount of standard complex formation may be quantified
by
various methods, but preferably by photometric means. Quantities of peptide,
polypeptide, or polynucleotide expressed in subject, control, and treated
samples (e.g.,
samples from vaccinated subjects) are compared with the standard values.
Deviation
=

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
64
between standard and subject values establishes the parameters for determining
the
presence or levels of the microbe.
In another embodiment of the invention, the polynucleotides may be used for
diagnostic
purposes using particular hybridization and/or amplification techniques. The
polynucleotides which may be used include oligonucleotides, complementary RNA
and
DNA molecules, and PNAs. The polynucleotides may be used to detect and
quantitate
gene expression in samples in which expression may be correlated with the
presence
or levels of a microbe: The diagnostic assay may be used to distinguish
between the
absence, presence, and alteration of microbe levels, and to monitor levels
during
therapeutic intervention.
In one aspect, hybridization with PCR probes may be used to identify nucleic
acid
sequences, especially genomic sequences, which encode the peptides or
polypeptides
of the invention. The specificity of the probe, whether it is made from a
highly specific
region, e.g., 10 unique nucleotides in the 5' regulatory region, or a less
specific region,
e.g., in the 3' coding region, and the stringency of the hybridization or
amplification
(maximal, high, intermediate, or low) will determine whether the probe
identifies only
naturally occurring sequences, alleles, or related sequences. Probes may also
be used
for the detection of related sequences, and should preferably contain at least
50% of
the nucleotides from any of the coding sequences. The hybridization probes of
the
subject invention may be DNA or RNA and derived from the nucleotide sequence
of
SEQ ID NO: 1-1718, or complements, or modified sequences thereof, or from
genomic
sequences including promoter and enhancer elements of the naturally occurring
sequence.
Means for producing specific hybridization probes for DNAs include the cloning
of
polynucleotides into vectors for the production of mRNA probes. Such vectors
are
known in the art, commercially available, and may be used to synthesize RNA
probes in
vitro by means of the addition of the appropriate RNA polymerases and the
appropriate
labeled nucleotides. Hybridization probes may be labeled by a variety of
reporter
groups, for example, radionuclides such as 32P or 33S, or enzymatic labels,
such as
alkaline phosphatase coupled to the probe via avidin/biotin coupling systems,
and the
like. The polynucleotides may be used in Southern or northern analysis, dot
blot, or
other membrane-based technologies; in PCR technologies; or in dipstick, pin,
ELISA

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
assays, or microarrays utilizing fluids or tissues from subject biopsies to
detect the
presence or levels of a microbe. Such qualitative or quantitative methods are
well
known in the art.
5 In a particular aspect, the polynucleotides may be useful in various
assays labelled by
standard methods, and added to a fluid or tissue sample from a subject under
conditions suitable for hybridization and/or amplification. After a suitable
incubation
period, the sample is washed and the signal is quantitated and compared with a
standard value. If the amount of signal in the test sample is significantly
altered from
10 that of a comparable control sample, the presence of altered levels of
nucleotide
sequences in the sample indicates the presence or levels of the microbe. Such
assays
may also be used to evaluate the efficacy of a particular vaccination regimen
in animal
studies, in clinical trials, or in monitoring the treatment of a subject.
15 In order to provide a basis for the diagnosis of the presence or levels
of a microbe, a
normal or standard profile for expression is established. This may be
accomplished by
combining body fluids or cell extracts taken from normal subjects, with a
polynucleotide
or a fragment thereof, under conditions suitable for hybridization and/or
amplification.
Standard levels may be quantified by comparing the values obtained from normal
20 subjects with those from an experiment where a known amount of a
substantially
purified polynucleotide is used. Standard values obtained from normal samples
may be
compared with values obtained from samples from subjects treated for microbial
growth. Deviation between standard and subject values is used to establish the
presence or levels of the microbe.
Once the microbe is identified and a vaccination protocol is initiated,
hybridization
and/or amplification assays may be repeated on a regular basis to evaluate
whether the
level of expression in the subject begins to decrease relative to that which
is observed
in the normal subject. The results obtained from successive assays may be used
to
show the efficacy of vaccination over a period ranging from several days to
months.
Particular diagnostic uses for oligonucleotides designed from the
polynucleotides may
involve the use of PCR. Such oligomers may be chemically synthesized,
generated
enzymatically, or produced in vitro. Oligomers will preferably consist of two
nucleotide
sequences, one with sense orientation (51.fwdarw.3') and another with
antisense

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
66
orientation (3'.fwdarw.5'), employed under optimized conditions for
identification of a
specific gene or condition. The same two oligomers, nested sets of oligomers,
or even a
degenerate pool of oligomers may be employed under less stringent conditions
for
detection and/or quantitation of closely related DNA or RNA sequences.
Methods which may also be used to quantitate expression include radiolabeling
or
biotinylating nucleotides, coamplification of a control nucleic acid, and
standard curves
onto which the experimental results are interpolated (Melby, P. C. et al.
(1993) J.
Immunol. Methods, 159:235-244; Duplaa, C. et al. (1993) Anal. Biochem. 229-
236). The
speed of quantitation of multiple samples may be accelerated by running the
assay in
an ELISA format where the oligomer of interest is presented in various
dilutions and a
spectrophotometric or colorimetric response gives rapid quantitation.
In further embodiments, oligonucleotides or longer fragments derived from any
of the
polynucleotides described herein may be used as targets in a microarray. The
microarray can be used to monitor the expression level of large numbers of
genes
simultaneously (to produce a transcript image), and to identify genetic
variants,
mutations and polymorphisms. This information may be used to determine gene
function, to understand the genetic basis of disease, to diagnose disease, and
to
develop and monitor the activities of therapeutic agents. In one embodiment,
the
microarray is prepared and used according to methods known in the art such as
those
described in PCT application WO 95/11995 (Chee et al.), Lockhart, D. J. et al.
(1996;
Nat. Biotech. 14: 1675-1680) and Schena, M. et al. (1996; Proc. Natl. Acad.
Sci. 93:
10614-10619).
In one aspect, the oligonucleotides may be synthesized on the surface of the
microarray
using a chemical coupling procedure and an ink jet application apparatus, such
as that
described in PCT application WO 95/251116 (Baldeschweiler et al.). In another
aspect,
a "gridded" array analogous to a dot or slot blot (HYBRIDOT apparatus, Life
Technologies) may be used to arrange and link cDNA fragments or
oligonucleotides to
the surface of a substrate using a vacuum system, thermal, UV, mechanical or
chemical
bonding procedures. In yet another aspect, an array may be produced by hand or
by
using available devices, materials, and machines (including multichannel
pipettors or .
robotic instruments; Brinkmann, Westbury, N.Y.) and may include, for example,
24, 48,
96, 384, 1024, 1536, or 6144 spots or wells (e.g., as a multiwell plate), or
more, or any

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
67
other multiple from 2 to 1,000,000 which lends itself to the efficient use of
commercially
available instrumentation.
In order to conduct sample analysis using the microarrays, polynucleotides are
extracted from a biological sample. The biological samples may be obtained
from any
bodily fluid (blood, urine, saliva, phlegm, gastric juices, etc.), cultured
cells, biopsies, or
other tissue preparations. To produce probes, the polynucleotides extracted
from the
sample are used to produce polynucleotides which are complementary to the
nucleic
acids on the microarray. If the microarray consists of cDNAs, antisense RNAs
are
appropriate probes. Therefore, in one aspect, mRNA is used to produce cDNA
which, in
turn and in the presence of fluorescent nucleotides, is used to produce
fragments or
antisense RNA probes. These fluorescently labeled probes are incubated with
the
microarray so that the probe sequences hybridize to the cDNA oligonucleotides
of the
microarray. In another aspect, polynucleotides used as probes can include
polynucleotides, fragments, and complementary or antisense sequences produced
using restriction enzymes, PCR technologies, and oligolabeling kits (Amersham
= Pharmacia Biotech) well known in the area of hybridization technology.
In another embodiment of the invention, the peptides or polypeptides of the
invention or
functional or immunogenic fragments or oligopeptides thereof, can be used for
screening libraries of compounds in any of a variety of drug screening
techniques. The
fragment employed in such screening may be free in solution, affixed to a
solid support,
borne on a cell surface, or located intracellularly. The formation of binding
complexes, -
between the peptide or polypeptide and the agent being tested, may be
measured.
One technique for drug screening which may be used provides for high
throughput
screening of compounds having suitable binding affinity to the peptide or
polypeptide of
interest as described in published PCT application WO 84/03564. In this
method, large
numbers of different small test compounds are synthesized on a solid
substrate, such
as plastic pins or some other surface. The test compounds are reacted with the
peptide
or polypeptide, or fragments thereof, and washed. Bound peptide or polypeptide
is then
detected by methods well known in the art. Purified peptide or polypeptide can
also be
coated directly onto plates for use in the aforementioned drug screening
techniques.
Alternatively, non-neutralizing antibodies can be used to capture the peptide
and
immobilize it on a solid support.
=

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
68
In another technique, one may use competitive drug screening assays in which
neutralizing antibodies capable of binding the peptide or polypeptide
specifically
compete with a test compound for binding to the peptide or polypeptide. In
this manner,
the antibodies can be used to detect the presence of a test compound which
shares
one or more antigen binding sites with the antibody.
Plant constructs and plant transformants
Of particular interest is the use of the polynucleotides of this invention for
plant
transformation or transfection. Exogenous genetic material may be transferred
into a
plant cell and the plant cell regenerated into a whole, fertile, or sterile
plant. Exogenous
genetic material is any genetic material, whether naturally occurring or
otherwise, from
any source that is capable of being inserted into any organism. Such genetic
material
may be transferred into either monocotyledons or dicotyledons including but
not limited
to the plants used for animal feed, e.g., feed for sheep, cows, etc.
A variety of methods can be used to generate stable transgenic plants. These
include
particle gun bombardment (Fromm et al., Biorrechnology 8:833-839 (1990)),
electroporation of protoplasts (Rhodes et al., Science 240:204-207 (1989);
Shimamoto
et al., Nature 338:274-276 (1989)), treatment of protoplasts with polyethylene
glycol
(Datta et al., Biorrechnology, 8:736-740 (1990)), microinjection (Neuhaus et
al.,
Theoretical and Applied Genetics, 75:30-36 (1987)), immersion of seeds in a
DNA
solution (Ledoux et al., Nature, 249:17-21 (1974)), and transformation with T-
DNA of
Agrobacterium (Valvekens et al., PNAS, 85:5536-5540 (1988); Komari, Plant
Science,
60:223-229 (1989)). In most, perhaps all plant species, Agrobacterium-mediated
transformation is the most efficient and easiest of these methods to use. T-
DNA transfer
generally produces the greatest number of transformed plants with the fewest
multi-
copy insertions, rearrangements, and other undesirable events.
Many different methods for generating transgenic plants using Agrobacterium
have
been described. In general, these methods rely on a "disarmed" Agrobacterium
strain
that is incapable of inducing tumours, and a binary plasmid transfer system.
The
disarmed strain has the oncogenic genes of the T-DNA deleted. A Binary plasmid
transfer system consists of one plasmid with the 23-base pair T-DNA left and
right

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
69
border sequences, between which a gene for a selectable marker (e.g. an
herbicide
resistance gene) and other desired genetic elements are cloned. Another
plasmid
encodes the Agrobacterium genes necessary for effecting the transfer of the
DNA
between the border sequences in the first plasmid. Plant tissue is exposed to
=Agrobacterium carrying the two plasmids, the DNA between the left and right
border
repeats is transferred into the plant cells, transformed cells are identified
using the
selectable marker, and whole plants are regenerated from the transformed
tissue. Plant
tissue types that have been reported to be transformed using variations of
this method
include: cultured protoplasts (Komari, Plant Science, 60:223-229 (1989)), leaf
disks
(Lloyd et al., Science 234:464-466 (1986)), shoot apices (Gould et al., Plant
Physiology,
95:426-434 (1991)), root segments (Valvekens et at., PNAS, 85:5536-5540
(1988)),
tuber disks (Jin et al., Journal of Bacteriology, 169: 4417-4425 (1987)), and
embryos
(Gordon-Kamm et at., Plant Cell, 2:603-618 (1990)).
In the case of Arabidopsis thaliana it is possible to perform in plant
germline
transformation (Katavic et at., Molecular and General Genetics, 245:363-370
(1994);
Clough et al., Plant Journal, 16:735-743 (1998)). In the simplest of these
methods,
flowering Arabidopsis plants are dipped into a culture of Agrobacterium such
as that .
described in the previous paragraph. Among the seeds produced from these
plants, 1%
or more have integration of T-DNA into the genome.
Monocot plants have generally been more difficult to transform with
Agrobacterium than _
dicot plants. However, "supervirulent" strains of Agrobacterium with increased
expression of the virB and virG genes have been reported to transform monocot
plants
with increased efficiency (Komari et al., Journal of Bacteriology, 166:88-94
(1986); Jin
et al., Journal of Bacteriology, 169:417-425 (1987
Most T-DNA insertion events are due to illegitimate recombination events and
are
targeted to random sites in the genome. However, given sufficient homology
between
= 30 the transferred DNA and genomic sequence, it has been reported that
integration of T-
DNA by homologous recombination may be obtained at a very low frequency. Even
with
long stretches of DNA homology, the frequency of integration by homologous
recombination relative to integration= by illegitimate recombination is
roughly 1:1000
= (Miao et at., Plant Journal, 7:359-365 (1995); Kempin et at., 389:802-803
(1997)).

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
Exogenous genetic material may be transferred into a plant cell by the use of
a DNA
vector or construct designed for such a purpose. Vectors have been engineered
for
transformation of large DNA inserts into plant genomes. Binary bacterial
artificial
chromosomes have been designed to replicate in both E. coil and Agrobacterium
and
5, have all of the features required for transferring large inserts of DNA
into plant
chromosomes. BAC vectors, e.g. a pBACwich, have been developed to achieve site-
directed integration of DNA into a genome.
A construct or vector may also include a plant promoter to express the gene or
gene
10 fragment of choice. A number of promoters that are active in plant cells
have been
described in the literature. These include the nopaline synthase (NOS)
promoter, the
octopine synthase (OCS) promoter, a caulimovirus promoter such as the CaMV 19S
promoter and the CaMV 35S promoter, the figwort mosaic virus 35S promoter, the
light-
inducible promoter from the small subunit of ribulose-1,5-bis-phosphate
carboxylase
15 (ssRUBISCO), the Adh promoter, the sucrose synthase promoter, the R gene
complex
promoter, and the chlorophyll a/b binding protein gene promoter.
For the purpose of expression in source tissues of the plant, such as the
leaf, seed,
root, or stem, it is preferred that the promoters utilized in the present
invention have
20 _ relatively high expression in these specific tissues. For this purpose,
one may choose
from a number of promoters for genes with tissue- or cell-specific or -
enhanced
expression. Examples of such promoters reported in the literature include the
chloroplast glutamine synthetase GS2 promoter from pea, the chloroplast
fructose-1,6-
biphosphatase (FBPase) promoter from wheat, the nuclear photosynthetic ST-LS1
25 promoter from potato, the phenylalanine ammonia-lyase (PAL) promoter and
the
chalcone synthase (CHS) promoter from Arabidopsis thaliana.
Also reported to be active in photosynthetically active tissues are the
ribulose-1,5-
bisphosphate carboxylase (RbcS) promoter from eastern larch (Larix laricina),
the
30 promoter for the cab gene, cab6, from pine, the promoter for the Cab-1
gene from
wheat, the promoter for the CAB-1 gene from spinach, the promoter for the
cab1R gene
from rice, the pyruvate, orthophosphate dikinase (PPDK) promoter from Zea
mays, the
promoter for the tobacco LhcbI*2 gene, the Arabidopsis thaliana SUC2 sucrose-
H+
symporter promoter, and the promoter for the thylacoid membrane proteins from
35 spinach (psaD, psaF, psaE, PC, FNR, atpC, atpD, cab, rbcS). Other
promoters for the

CA 2772224 2017-03-13
71
¨ chlorophyll a/b-binding proteins may also be utilized in the present
invention, such as
the promoters for LhcB gene and PsbP gene from white mustard (Sinapis alba).
Additional promoters that may be utilized are described, for example, in U.S.
Pat. Nos.
5,378,619; 5,391,725; 5,428,147; 5,447,858; 5,608,144; 5,608,144; 5,614,399;
5,633,441; 5,633,435 and 4,633,436.
Constructs or vectors may also include, with the coding region of interest, a
nucleic acid
sequence that acts, in whole or in part, to terminate transcription of that
region. For
example, such sequences have been isolated including the Tr7 3' sequence and
the
nos 3' sequence or the like. It is understood that one or more sequences of
the present
invention that act to terminate transcription may be used.
A vector or construct may also include otherregulatory elements or selectable
markers.
Selectable markers may also be used to select for plants or plant cells that
contain the
exogenous genetic material. Examples of such include, but are not limited to,
a neo
gene which codes for kanamycin resistance and can be selected for using
kanamycin,
G418, etc.; a bar gene which codes for bialaphos resistance; a mutant EPSP
synthase
gene which encodes glyphosate resistance; a nitrilase gene which confers
resistance to
bromoxynil, a mutant acetolactate synthase gene (ALS) which confers
imidazolinone or
sulphonylurea resistance; and a methotrexate resistant DHFR gene.
A vector or construct may also include a screenable marker to monitor
expression.
Exemplary screenable markers include a .beta.-glucuronidase or uidA gene
(GUS), an
' R-locus gene, which encodes a product that regulates the production of
anthocyanin
pigments= (red colour) in plant tissues; a beta-lactamase gene, a gene which
encodes
an enzyme for which various chromogenic substrates are known (e.g., PADAC, a
chromogenic cephalosporin); a luciferase gene, a xylE gene which encodes a
catechol
dioxygenase that can convert chromogenic catechols; an alpha-amylase gene, a
tyrosinase gene which encodes an enzyme capable of oxidizing tyrosine to DOPA
and
dopaquinone which in turn condenses to melanin; an alpha-galactosidase, which
will
turn a chromogenic alpha-galactose substrate.
Included within the terms "selectable or screenable marker genes" are also
genes which
encode a secretable marker whose secretion can be detected as a means of
identifying

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
72
or selecting for transformed cells. Examples include markers which encode a
secretable
antigen that can be identified by antibody interaction, or even secretable
enzymes
which can be detected catalytically. Secretable proteins fall into a number of
classes,
including small, diffusible proteins detectable, e.g., by ELISA, small active
enzymes
detectable in extracellular solution (e.g., alpha-amylase, beta-lactamase,
phosphinothricin transferase), or proteins which are inserted or trapped in
the cell wall
(such as proteins which include a leader sequence such as that found in the
expression
unit of extension or tobacco PR-S). Other possible selectable and/or
screenable marker
genes will be apparent to those of skill in the art.
Thus, any of the polynucleotides of the present invention may be introduced
into a plant
cell in a permanent or transient manner in combination with other genetic
elements
such as vectors, promoters enhancers etc. Further any of the polynucleotides
encoding
a protein or fragment thereof or homologs of the present invention may be
introduced
into a plant cell in a manner that allows for expression (e.g.,
overexpression) of the
protein or fragment thereof encoded by the polynucleotide.
Computer related uses
In one embodiment, a nucleotide or amino acid sequence of the present
invention can
be recorded on computer readable media. This takes into account any medium
which
can be read and accessed directly by a computer. Such media include, but are
not
limited to: magnetic storage media, such as floppy discs, hard disc storage
medium,
and magnetic tape; optical storage media such as CD-ROM; electrical storage
media
such as RAM and ROM; and hybrids of these categories such as magnetic/optical
storage media. A skilled artisan can readily appreciate how any of the
presently known
computer readable mediums can be used to create a manufacture comprising
computer
readable medium having recorded thereon a sequence of the present invention.
A skilled artisan can readily adopt any of the presently know methods for
recording
information on computer readable medium to generate manufactures comprising
the
nucleotide sequence information of the present invention. A variety of data
storage
structures are available to a skilled artisan for creating a computer readable
medium
having recorded thereon a nucleotide sequence of the present invention. The
choice of
the data storage structure will generally be based on the means chosen to
access the

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
73
stored information. In addition, a variety of data processor programs and
formats can be
used to store the nucleotide sequence information of the present invention on
computer
readable medium.
As non limiting examples, the sequence information can be represented in a
word
processing text file, formatted in commercially-available software such as
WordPerfect
and Microsoft Word, or represented in the form of an ASCII file, stored in a
database
application, such as DB2, Sybase, Oracle, or the like. A skilled artisan can
readily adapt
any number of data processor structuring formats (e.g. text file or database)
in order to
obtain computer readable medium having recorded thereon the nucleotide
sequence
information of the present invention.
By providing the sequence of any SEQ ID NO: herein, or a representative
fragment
thereof, or any variant thereof, in computer readable form, a skilled artisan
can routinely
access the sequence information for a variety of purposes. Computer software
is
publicly available which allows a skilled artisan to access sequence
information
provided in a computer readable medium. For example, software can be used to
implement the BLAST (Altschul et al., J. Mol. Biol. 215:403-410 (1990)) and
BLAZE
(Brutlag et al., Comp. Chem. 17:203-207 (1993)) search algorithms, e.g., on a
Sybase
system to identify ,open reading frames (ORFs) which contain homology to ORFs
or
proteins from other organisms. Such ORFs may be protein encoding sequences
which
are useful in producing commercially important proteins such as enzymes.
The present invention further provides systems, particularly computer-based
systems,
which contain the sequence information described herein. Such systems are
designed
to identify commercially important sequences of the M. ruminantium genome.
This
includes the hardware means, software means, and data storage means used to
analyze the nucleotide sequence information of the present invention. The
minimum
hardware means of the computer-based systems of the present invention
comprises a
central processing unit (CPU), input means, output means, and data storage
means. A
skilled artisan can readily appreciate that any one of the currently available
computer-
based system are suitable for use in the present invention.
As stated above, the computer-based systems of the present invention comprise
a data
storage means having stored therein a nucleotide sequence of the present
invention

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
74
and the necessary hardware means and software- means for supporting and
implementing a search means. This refers to memory which can store nucleotide
sequence information of the present invention, or a memory access means which
can
access manufactures having recorded thereon the nucleotide sequence
information of
the present invention. Searching can include one or more programs which are
implemented on the computer-based system to compare a target sequence or
target
structural motif with the sequence information stored within the data storage
means.
Search means are used to identify fragments or regions of the M. ruminantium
genome
which match a particular target sequence or target motif, e.g., antibody
targets. A
variety of known algorithms are disclosed publicly and a variety of
commercially
available software for conducting search means are and can be used in the
computer-
based systems of the present invention. Examples of such software include, but
are not
limited to, MacPattem (EMBL), BLASTN and BLASTX (NCBIA). A skilled artisan can
readily recognize that any one of the available algorithms or implementing
software
packages for conducting homology searches can be adapted for use in the
present
computer-based systems.
The target sequence can be any DNA or amino acid sequence of six or more
nucleotides or two or more amino acids. A skilled artisan can readily
recognize that the
longer a target sequence is, the less likely a target sequence will be present
as a
random occurrence in the database. The most preferred sequence length of a
target
sequence is from about 10 to 100 amino acids or from about 30 to 300
nucleotide
residues. However, it is well recognized that searches for commercially
important
fragments of the M. ruminantium genome, such as sequence fragments involved in
gene expression and protein processing, may be of shorter length.
A target structural motif, or target motif includes any rationally selected
sequence or
combination of sequences in which the sequence(s) are chosen based on a three-
dimensional configuration which is formed upon the folding of the target
motif. There are
= a variety of target motifs known in the art. Protein target motifs
include, but are not
limited to, enzyme active sites and signal sequences. Nucleic acid target
motifs include,
but are not limited to, promoter sequences, hairpin structures and inducible
expression
elements (protein binding sequences).

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
A variety of structural formats for the input and output means can be used to
input and
output the information in the computer-based systems of the present invention.
A
preferred format for an output means ranks fragments of the M. ruminantium
genome
possessing varying degrees of homology to the target sequence or target motif.
Such
5 presentation provides a skilled artisan with a ranking of sequences which
contain
various amounts of the target sequence or target motif and identifies the
degree of
homology contained in the identified fragment.
A variety of comparing means can be used to compare a target sequence or
target
10 motif with the data storage means to identify sequence fragments of the
M. ruminantium
genome. In particular aspects, software can be used implement the BLAST and
BLAZE
algorithms (Altschul et al., J. Mol. Biol. 215:403-410. (1990)) and to
identify open
reading frames. A skilled artisan can readily recognize that any one of the
publicly
available homology search programs can be used as the search means for the
15 computer-based systems of the present invention
The computer system may include a processor connected to a bus. Also connected
to
the bus may be a main memory (preferably implemented as random access memory,
RAM) and a variety of secondary storage devices, such as a hard drive and a
20 removable medium storage device. The removable medium storage device may
represent, for example, a floppy disk drive, a CD-ROM drive, a magnetic tape
drive, etc.
A removable storage medium (such as a floppy disk, a compact disk, a magnetic
tape,
etc.) containing control logic and/or data recorded therein may be inserted
into the
removable medium storage device. The computer system may include appropriate
25 software for reading the control logic and/or the data from the removable
medium
storage device once inserted in the removable medium storage device.
A sequence of the present invention may be stored in a well known manner in
the main
memory, any of the secondary storage devices, and/or a removable storage
medium.
30 Software for accessing and processing the genomic sequence (such as
search tools,
comparing tools, etc.) reside in main memory during execution.

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
76
EXAMPLES
The examples described herein are for purposes of illustrating embodiments of
the
invention. Other embodiments, methods, and types of analyses are within the
scope of
persons of ordinary skill in the molecular diagnostic arts and need not be
described in
detail hereon. Other embodiments within the scope of the art are considered to
be part
of this invention.
EXAMPLE 1: Materials and methods
Strain information and growth conditions
Methanobrevibacter ruminantium MIT (DSM1093) was obtained from the German
Collection of Microorganisms and Cell Cultures (DSMZ), Braunschweig, Germany.
The
original description of Methanobacterium ruminantium was made by Smith and
Hungate
(Smith & Hungate, 1958) and the genus designation later changed to
Methanobrevibacter (Balch et al., 1979). Methanobrevibacter ruminantium MIT
=
(DSM1093) was isolated from bovine rumen contents by Bryant (Bryant, 1965). It
is
designated the neotype strain for this species because the original strain of
Smith and
Hungate was not maintained. M. ruminantium strain M1T was routinely grown in
basal
medium (Joblin et al., 1990) with added trace elements (Balch et al., 1979),
(Br
medium), with H2 plus CO2 (4:1) at 180 kPa overpressure. The culture tubes
were
incubated on their sides, at 39 C in the dark, on a platform shaken at 200
rpm.
Co-culture of M. ruminantium and Butyrivibrio proteoclasticus
M1 was grown in co-culture with Butrivibrio proteoclasticus B316T (DSM14932)
to
examine gene expression under rumen-like conditions. Eighteen pure cultures of
M1
were grown in Br medium with H2 plus CO2 (4:1) at 180 kPa overpressure in 100
ml
volumes in 125 ml serum bottles sealed with blue butyl septum stoppers and
aluminium
seals (Bellco Glass, Vineland, NJ, USA). When the cultures reached mid-
exponential
phase, as measured by optical density at 600 nm (Ultrospec 1100 pro UVNis
spectrophotometer, Amersham Biosciences, Little Chalfont, Buckinghamshire, UK)
they
were flushed with 02-free 100% CO2 gas until H2 was not detectible by gas
chromatography. All 18 cultures were supplemented with oat spelt )(Irian
(Sigma-Aldrich,
St. Louis, MO, USA) to 0.2% (w1v) final concentration, then nine of the
cultures were
inoculated with 0.5 ml of a late-exponential phase culture of B.
proteoclasticus. The

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
77
other nine were re-pressurized to H2 plus CO2 (4:1) at 180 kPa overpressure.
Three
further serum bottles of BY medium supplemented with 0.2% (w/v) xylan were
also
inoculated with an equivalent inoculum of B. proteoclasticus. Growth in the co-
culture
was monitored periodically by Thoma slide enumeration (Webber Scientific
International
Ltd., Teddington, England). Mid-exponential phase co-cultures and monocultures
were
harvested by centrifugation (10,000 X g, 5 min at 4 C), and the cell pellets
resuspended
in 10 ml of BY medium (4- 0.2% [w/v] xylan) and 20 ml of RNAprotect (Qiagen,
Hilden,
Germany). These were incubated for 5 min at room temperature, and were
immediately
processed for RNA extraction
Microarray analyses
RNA isolation, cDNA synthesis and labelling. Cells of M1 and B.
proteoclasticus from
mono- or co-cultures prepared as described above, were pelleted by.
centrifugation
(5,000 x g, 10 min room temperature), air-dried and frozen .under liquid N2.
Frozen
pellets were ground in a sterile pre-chilled (-20 C) mortar and pestle under
liquid N2,
and the ground samples resuspended in excess TRIzol (Invitrogen, Carlsbad, CA,
USA). The mixtures were incubated at 20 C for 5 min. Chloroform (200 pl) was
then
added, mixed vigorously, and incubated for a further 3 min. The samples were
centrifuged (12,000 x g, 15 min, 4 C) and the aqueous phases transferred to
fresh
tubes, mixed with 0.5 volumes isopropanol and incubated at 20 C for 10 min to
precipitate the RNAs. Precipitated RNAs were pelleted by centrifugation
(12,000 x g,
10 min, 4 C), the supernatants removed and the RNAs washed with 5 ml of 75%
(v/v)
ethanol before being re-pelleted by centrifugation. Ethanol was removed, the
pellets air
dried on ice and finally each resuspended in 1 ml of diethyl pyrocarbonate
(DEPC)
treated Milli-Q water. The RNAs were further purified using an RNeasy Midi kit
(Qiagen, Hilden, Germany) and quantified using an Agilent 2100 Bioanalyzer
(Agilent
Technologies, Santa Clara, CA, USA) following the respective manufacturer's
instructions. cDNA synthesis, labeling and purification were carried out using
the
Invitrogen cDNA labelling purification kit, while the Cy3 and Cy5 dyes were
from GE
Healthcare (Uppsala, Sweden).
Quantification of co-culture mRNA. The relative quantities of RNAs contributed
by each
organism to the co-culture samples were determined by quantitative PCR of the
B. proteoclasticus butyryl-CoA dehydrogenase (bcd) gene (using primers bcdqfp:
tgagaagggaacacctggat; SEQ ID NO: 7586, and bcdqrp: ttgctcttccgaactgctt; SEQ ID
NO:

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
78
7587), and the M1 gene encoding N51N10-methenyl-H4MPT cyclohydrolase (mch)
(using
primers mchqfp: gtattgcctggtgaagatgt; SEQ ID NO: 7588 and mchqrp:
gtcgatttggtagaagtca; SEQ ID NO: 7589). Homologs of both genes have previously
been
shown to be. constitutively expressed in closely related species (Reeve et
al., 1997;
Asanuma et al., 2005). The mono-culture RNAs were then combined in equal
proportions to normalise mRNA abundance with their co-culture replicates.
Probe synthesis and slide printing. Oligonucleotide 70mer probes were designed
against the draft genomes of M1 and Butyrivibrio proteoclasticus B316T using
ROSO
software (Reymond et al., 2004) and synthesised by IIlumina (San Diego, CA,
USA).
Oligonucleotides were spotted onto epoxy-coated slides (Corning, Lowell, MA,
USA)
using an ESI robot (Engineer Service Inc., Toronto, Ontario, Canada).
Microarray hybridization and scanning. Microarrays were replicated 6 times (3
biological replicates" per treatment, each with a dye swap) and each gene was
represented on the array 3 to 7 times. Microarray slides were pre-warmed in
microarray
prehybridization buffer (50 C for 30 min), and transferred into hybridization
chambers
(Corning, Lowell, MA, USA) and lifter cover slips (Erie Scientific,
Portsmouth, NH, USA)
were laid over the probe areas. Samples of RNA to be compared (e.g., Cy3 co-
culture
versus combined Cy5 individual mono-cultures) were combined, denatured at 95 C
for
10 min, and mixed with 60 pl of pre-warmed (68 C) Slide Hyb buffer #1 (Ambion,
Austin, TX, USA). The mixture was loaded onto the slide, the hybridization
chamber
sealed, and incubated in a water bath at 50 C for 24 h. Following
hybridization, the
slides were washed by vigorous shaking by hand in pre-warmed (50 C) wash
solutions
1 to 3 (wash solution 1: 10%SDS, 2 x SSC; wash solution 2: 1 x SSC; wash
solution 3:
0.1 x SSC), 7 min per wash in aluminium foil-covered Falcon tubes (Becton,
Dickinson
and Co. Sparks, MD, USA). Following the third wash, the slides were dried by
low
speed centrifugation (1,500 x g, 4 min) followed by incubation for 20 min in a
37 C
vacuum oven (Contherm, Wellington, NZ) in the dark. Microarray slides were
scanned
using a GenePixe Professional 4200 scanner and GenePix Pro 6.0 software
(Molecular
Devices, Sunnyvale, CA, USA) and analysed using the Limma package in
Bioconductor
(Smyth, 2005). Genes with an up- or down-regulation of 2 fold or greater and
an FOR
value < 0.05 were deemed statistically significant.
Growth experiments to test effects of PeiR and alcohols

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
79
M1 was grown in medium RM02 in anaerobic culture tubes (16 mm internal
diameter,
18 mm outer diamater, 150 mm long; BeIlco Glass, Vineland, NJ, USA),
essentially as
described by Balch and Wolfe, 1976. The mineral salts base of RM02 contained
(per
litre of medium): 1.4 g of KH2PO4, 0.6 g of (NH4)2SO4, 1.5 g of KCI, 1 ml
trace element
solution SL10 (Widdel et al., 1983), 1 ml of selenite/tungstate solution
(Tschech and
Pfennig, 1984) and 4 drops of 0.1% (w/v) resazurin solution. This solution was
mixed
and then boiled under 02-free 100% CO2, before being cooled in an ice bath
while it
was bubbled with 100% 002. Once the medium was cool, 4.2 g of NaHCO3 and 0.5 g
of
L-cysteine-HCI-H20 was added per litre. The medium was dispensed into the
culture
tubes while being gassed with 100% CO2, at 9.5 ml of medium per tube, and the
tubes
sealed with blue butyl septum stoppers and aluminium seals (BelIco), with a
headspace
of 100% CO2. These tubes were sterilised by autoclaving for 20 min at 121 C.
Before
use, the tubes were stored in the dark for at least 24 h. Sodium acetate (20
mM final
conc.), sodium formate (60 mM final conc.), coenzyme M (10 pM final conc.),
and
vitamin-supplemented clarified rumen fluid were added to sterile media, before
inoculation with 0.5 ml of an actively growing culture of M. ruminantium, then
gassed
with H2 plus CO2 (4:1) to 180 kPa overpressure. In some experiments, the
formate was
omitted, and alcohols were added, as noted in, the experimental descriptions
accompanying the results. The culture tubes were incubated on their sides, at
39 C in
the dark, on a platform shaken at 200 rpm.
To prepare the clarified rumen fluid, rumen contents were collected from a
ruminally-
fistulated cow that had been fed hay for 48 h after being on a rye-grass
clover pasture.
Feed was withheld from the animal overnight and rumen contents collected the
next
morning. The material was filtered through a single layer of cheesecloth and
then fine
particulate material removed by centrifugation at 10,000 x g for 20 min. The
supernatant
was stored at -20 C. Before further use, it was thawed, and any precipitates
removed
by centrifugation at 12,000 x g for 15 min. The supernatant was bubbled for 10
min with
100% N2 gas, before being autoclaved under 100% nitrogen for 15 min to remove
viruses. The following was then added per 100 ml of rumen fluid while stirring
under air:
1.63 g of MgC12=6H20 and 1.18 g of CaCl2-2H20. The resulting heavy precipitate
was
removed by centrifuging at 30,000 X g and 4 C for 60 min. The supernatant was
designated the clarified rumen fluid. Two grams of yeast extract powder was
added,
and the mixture then bubbled with N2 gas for 15 min, before being transferred
to a N2-

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
flushed sterile serum vial through a 0.2-pm pore size sterile filter using a
syringe and
needle.
Two ml of Vitamin 10 concentrate was then added per 100 ml of preparation by
syringe
5 and needle. Vitamin 10 concentrate contained 1000 ml of distilled water,
40 mg of
4-aminobenzoate, 10 mg of D-(+)-biotin, 100 mg of nicotinic acid, 50 mg of
hemicalcium
D-(+)-pantothenate, 150 mg of pyridoxamine hydrochloride, 100 mg of thiamine
chloride
hydrochloride, 50 mg of cyanocobalamin, 30 mg of D,L-6,8-thioctic acid, 30 mg
of
riboflavin and 10 mg of folic acid. After preparation, the solution was well
mixed and
10 then bubbled with N2 gas for 15 min, before being transferred to a N2-
flushed sterile
= serum vial through a 0.2 pm pore size sterile filter using a syringe and
needle.
Growth of M1 was followed by measuring the culture density at 600 nm by
inserting the
tubes 'directly into an Ultrospec 1100 pro UVNis spectrophotometer (Amersham
15 Biosciences, Little Chalfont, Buckinghamshire, UK). Tubes containing 10
ml of medium
RM02 were inoculated with 0.5 ml of an actively growing culture of Ml, then
gassed
with H2 plus CO2 (4:1) to 180 kPa overpressure. Additions of PeiR in 0.1 ml of
buffer (20
mM 3[N-morpholino]propane sulfonic acid: 1 mM dithiothreitol: 0.3 M NaCl, 20%
glycerol [v/v], pH 7.0 with NaOH), 0.1 ml of buffer only, or 0.1 ml of
chloroform were
20 made when the cultures had grown to mid-exponential phase (optical
density at 600 nm
[OD600] ¨0.1, 16 mm path length). In the experiments testing the effects of
PeiR
addition, the culture densities were mathematically normalised to an 0D600 of
0.1 at the
time the additions were made, and all other readings corrected by the same
ratio. This
was done to remove the effect of lack of absolute synchronicity between
cultures, a
25 common phenomenon when culturing methanogens. This normalisation was not
done
for experiments testing the utilisation of alcohols. Methane was measured by
gas
chromatography, taking a 0.3 ml sample from the culture headspace, at the
pressure in
the culture tube, and injecting it into an Aerograph 660 (Varian Associates,
Palo Alto,
CA, USA) fitted with a Porapak Q 80/100 mesh column (Waters Corporation,
Milford,
30 MA, USA) and a thermal conductivity detector operated at 100 C. The column
was
operated at room temperature with N2 as the carrier gas at 12 cm3/min.
DNA extraction
Genomic DNA was extracted from M1 grown on BY medium with H2 plus CO2 (4:1),
35 using the liquid N2 freezing and grinding method (Jarrell et al., 1992).
Briefly, M1

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
81
cultures were harvested by centrifugation at 27,000 x g for 20 min at 4 C and
cell
pellets combined and placed into 40 ml Oakridge centrifuge tubes (Thermo
Fisher
Scientific, Inc.). The cells were frozen at -20 C and kept frozen for at least
4 days. The
frozen cell pellets were placed in a sterile, pre-cooled (-85 C) mortar and
liquid N2
poured over the pellet. After the N2 had evaporated, the pellet was ground to
a powder
with a sterile glass rod. Immediately, 0.5 ml of TES buffer (10 mM Tris-HCI :
1 mM
EDTA:0.25 M sucrose, pH 7.5) was added to the powdered cell pellet and mixed
gently
into a slurry. Sodium dodecyl sulfate was added to a final concentration of 1%
(w/v)
and Proteinase = K (Roche Diagnostics, Mannheim, Germany) added to a final
concentration of 50 ig/ml. The mixture was incubated at 60 C for 30 min. NaCI
was
added to a final concentration of 0.5 M and the lysate was placed on ice for 1
h. The
lysate was centrifuged at 25,000 x g for 15 min at 4 C and the supematant
recovered
carefully. An equal volume of cold (4 C) isopropanol was added to the
supernatant, and
the precipitated DNA was collected by centrifugation at 12,000 X g for 10 min
at room
temperature and re-dissolved in TE buffer (10 mM Tris-HCI: 1 mM EDTA, pH 7.5).
The
DNA was treated with RNase (10 pg/m1), (Sigma-Aldrich) for 30 min at 37 C, and
extracted twice with an equal volume of phenol/chloroform/isoamyl alcohol
(25:24:1)
and twice with an equal volume of chloroform alone. NaCI was added to a final
concentration of 0.5 M and the DNA precipitated by adding 2.5 volumes of cold
(4 C)
ethanol. The precipitated DNA was collected by centrifugation at 14,000 X g
for 10 min
at 4 C and re-dissolved in TE buffer.
Pulsed-field gel electrophoresis (PFGE)
Standard PFGE protocol involves embedding cells in agarose and lysis with
lysozyme
and/or proteases, but this was not possible with M1 because its pseudomurein-
containing cell wall was resistant to lysis by commercially available enzymes.
In order to
overcome this, the cell pellet from a centrifuged 50 ml culture was frozen
with liquid N2
and very gently ground in a pestle and mortar to damage the cell wall. The
ground
material was allowed to thaw, 2 ml of 1 M NaCI plus 10 mM Tris (pH 7.6) was
added
and 300 1F aliquots were mixed with an equal volume of 2% (w/v) low melt
agarose
(Bio-Rad Laboratories, Hercules, CA, USA). Embedded cells were treated with
0.1 mg
m1-1 Proteinase K in lysis buffer (50 mM Tris-HCI : 50 nriM EDTA: 1% [w/v]
sarkosyl, pH
=
8.0) at 50 C for up to 24 h. The agarose plugs were washed twice with sterile
water and
three times with TE buffer (10 mM Tris-HCI : 1 mM EDTA, pH 8.0) before storage
in 10
mM Tris-HCI: 100 mM EDTA (pH 8.0) at 4 C. DNA embedded in agarose was digested

82
for 16 h with 1.0 U of Apal, Bssi-111 or M/u1 (New England Biolabs, Beverly,
MA, USA) in
100 pl of restriction enzyme buffer, loaded into wells of 1% (w/v) agarose
gels (SeaKem
= Gold agarose, Cambrex Bio Science, Rockland, ME, USA), and run at 200 V
for 20 h at
14 C in 0.5X Tris-borate buffer using a CHEF DR Ill PFGE apparatus and model
1000
mini chiller (Bio-Rad). Double-digest combinations of these enzymes were
digested and
run in the same way. DNA was visualized by staining with ethidium bromide and
the
image captured using a Gel Doc 1000 system (Kodak Gel Logic 200 Imaging
System,
Eastman Kodak, Rochester, NY, USA).
Genome sequencing, assembly and validation
The genome sequence of M1 was determined using a whole genome shotgun strategy
(Agencourt Biosciences, USA) and a pyrosequencing approach (Macrogen, USA). A
hybrid assembly (Goldberg et al., 2006) was performed utilising the Staden
package
(Sladen & Bonfield, 2000), Phred (Ewing et al., 1998), Phrap, Paracel (Paracel
Inc.)
and Repeatnnasker resulting in a 27
cortig assembly. Gaps were closed using additional sequencing by PCR-based
techniques. Quality _improvement of the genome sequence was performed using
standard PCR to ensure correct assembly and the resolution of any remaining-
base- .
conflicts. Assembly validation was confirmed by pulsed-field gel
electrophoresis (see
above).
=
Genome analysis and annotation
A GAMOLA (Alterrnann and Klaenhammer, 2003) Artemis (Rutherford et al., mop)
software suite was used to manage genome annotation. Protein-encoding open
reading
frames (ORES) were identified using the ORF-prediction program Glimmer
(Delcher et
al., 1999) and BLASTX (Gish & States, 1993). A manual inspection was performed
to
verify or, if necessary, redefine the start and stop of each ORF. Assignment
of protein
function to ORFs was performed manually using results from the following
sources;
BLASTP (Altschul et al., 1990) to both a non-redundant protein database
provided by
the National Centre for Biotechnology Information (NCB!) (Sayers et al., 2009)
and
clusters of orthologous groups (COG) (Tatusov et al., 2000) database. HMMER
(Eddy,
1998) was used to identify protein motifs to both the PFAM (Finn et al., 2008)
and
TIGRFAM (Haft et al., 2003) libraries. TMHMM (Krogh et al., 2001)
was used to predict transmembrane
CA 2772224 2018-05-04

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
83
sequences, and SignalP (Bendtsen et al., 2004) was used for the prediction of
signal =
peptides.
Ribosomal RNA genes were detected on the basis of BLASTN searches to a custom
GAMOLA ribosomal database. Transfer RNA genes were identified using tRNAscan-
SE (Lowe & Eddy, 1997). Miscellaneous-coding RNAs were identified using the
Rfam
database utilizing the INFERNAL software package (Eddy, 2002). Insertion
sequence
elements were identified using Repeaffinder (Volfovsky et al., 2001) and BLAST
and
annotated manually. Genome atlas visualisations were constructed using GENEWIZ
(Jensen et al., 1999). Horizontal gene transfer studies were performed using
Darkhorse
(Podell & Gaasterland, 2007), GC% content (Rice et al., 2000) and the Codon
Adaptation Index (Sharp & Li, 1987). A BLAST analysis was performed against
the
arCOG (Makarova et al., 2007) database. Analysis of non-ribosomal peptide
synthetases (NRPSs) was performed using NRPSpredictor (Rausch et al., 2005).
An
LPxTG-HMM (Boekhorst et al., 2005) was used for the identification of LPxTG
motifs.
Metabolic pathway reconstructions were performed using Pathway Voyager
(Altermann
& Klaenhammer, 2005) and the KEGG (Kyoto Encyclopedia of Genes and Genomes)
database (Kanehisa & Goto, 2000) combined with an extensive review of the
literature.
Identification of open reading frames (ORFs) as vaccine and drug targets was
performed as described. Genome sequences used in comparative studies were
downloaded from the National Centre for Biotechnology Information (NCB!) FTP
website and are listed in Table 10, below.
Genome sequence was prepared for NCBI submission using Sequin (Benson et al.,
2009). The adenine residue of the start codon of the Cdc6-1 (mru0001) gene was
chosen as the first base for the M1 genome. For GC skew and synteny analysis,
the
sequences of genonnes of other members of the order Methanobacteriales were
rotated
to begin at the same location. GC skew analysis was performed by circular
diagram.pl
(Rutherford, K, Sanger Centre software) and synteny plots were generated using
MUMmer3.0 (Delcher et al., 2003).
Vaccine target ORF identification
Vaccine targets are likely to be surface exposed or membrane associated and
conserved among methanogens or archaeal species. Methanogens are the only
known
resident archaea in the rumen and therefore archaeal specific candidates were
not

84
omitted from target lists, likewise when present, sequence homology to
proteins
associated with known vaccine or drug design remained a strong element for
target
selection regardless of other criteria. To identify the surface-exposed or
membrane-
associated ORFs of M1 a combination of methods was utilized. To date, there is
no
. 5 signal peptide model for archaea. There are simply too few
experimentally verified
secretory proteins available for Archaea to train a specific model. For this
reason ORF
sequences were analysed for the presence of signal peptides using SignalP
Version 3.0
(Bendtsen et al., 2004) trained against the Gram-positive, Grain-negative 'and
Eukaryotic models and the results combined. SignaIP-HMM (hidden markov models)
was used to discriminate between signal peptide and non-signal peptide ORFs
whereas
SignaIP-NN (neural networks) was utilized for the prediction of cleavage sites
as
described by Emanuelsson et al., 2007 (Emanuelsson et al., 2007). TMHMM (Krogh
et
al., 2001) was used for the prediction of
transmembrane domains and (Nakai & Horton, 1999) PSORT trained on a Gram-
positive model was used to predict a protein's subcellular localization.
BLASTP results .
were analyzed to identify methanogen specific ORFs.
-Chemogenomics target ORF identification
Three different approaches were utilized to identify candidate chemogenomics
targets.
Metabolic profiling analyses. Several factors were taken into consideration
when
performing this analysis. Utilizing the metabolic reconstruction of M1 and an
extensive
review of the literature, archaeal- or methanogen-specific enzymes, or enzymes
with -
sufficient structural or biochemical differences compared to their bacterial
or eukaryl
counterparts were identified. Some methanogen enzymes or pathways that have
been
previously targeted by researchers for inhibition demonstrating the
essentiality of certain
enzymes/pathways were also taken into consideration. In addition, a few
enzymes
which represent key enzymes to several pathways or are well known validated
targets
in pathogenic bacteria or parasites, whilst still retaining sufficient
sequence divergence
to potentially be able to be targeted effectively were also included. Most of
the cell wall
enzymes are listed as the majority of successful antibiotics that have been
developed
=against pathogenic bacteria target cell wall biosynthesis. Methanobacterial
cell wall
synthesis, despite apparently sharing some common enzymes (e.g., mur ligases)
is
widely divergent in biochemical terms -from bacterial cell wall synthesis and
the
homologous enzymes share only limited sequence homology. The degree to which
CA 2772224 2018-05-04

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
strain Ml, or other rumen methanogens, are able to utilize amino acids,
vitamins, or
purine or pyrimidine compounds in rumen fluid is under investigation.
Functional genome distribution (FGD). A FGD analysis (Altermann 2009,
manuscript in
5 preparation) was performed using 26 publicly available draft and complete
methanogen
genome sequences (dbMethano, Table 10). In contrast to an evolutionary
phylogeny,
FGD analyzes the functional relationship between microbes based on their
predicted
ORFeomes. FGD is a comparative genomics approach to genome-genome
comparisons, emphasizing functional relationships rather than ancestral
lineages.
10 .. Briefly, pooled ORFeomes are subjected to all-vs-all analyses,
evaluating the level and
quality of amino-acid similarities between individual ORFs pairings.
Individual results for
each genome-genome combination are then combined into a symmetrical distance
matrix and can be visualized using the Unweighted Pair Group Method with
Arithmetic
mean (UPGMA) method (Sneath and Sokal, 1973) Numerical Taxonomy. Freeman, San
15 Francisco. Strain and cluster conserved and specific gene sets were
mined based on
respective BLAST e-values, using custom developed software.
Differential Blast Analysis (DBA). The reference genome of M1 was subjected to
analysis against two BLASTP databases using GAMOLA (Altermann and
20 Klaenhammer, 2003). The first amino-acid database= employed all methanogen
ORFeomes used in the FGD analysis (dbMethano), while the second database was
comprised of the non-redundant database (nr) as provided by NCBI, excluding
hits to
genera used in dbMethano. E-values of best BLASTP hits for both database sets
were
consolidated into an empirically determined e-value trust level range (fT
e-valueD and their
25 respective
differential calculated as follows: A = (Tnr TdbMethano)= Results were
visualized on a genome atlas using Genewiz (Jensen et al., 1999) and software
developed in-house.
Peptide vaccine methods
30 The use of synthetic peptides to raise antibodies against predicted M1
surface proteins
was investigated. The M1 proteins encoding the membrane-spanning subunits of
tetrahydromethanopterin S-methyltransferase (MtrCDE, mru1921, 1922 and 1923),
adhesin-like proteins (mru2049, 0842, 0143 and 2048) and a magnesium chelatase
subunit H (BchH, mru2047) containing N-terminal and C-terminal TMHs, were
analysed
35 to identify extracellular peptide sequences which might serve as
potential antibody

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
86
binding sites. Nine suitable peptide sequences from extracellular regions of
these eight
proteins were identified and used to guide the manufacture of the
corresponding
synthetic peptides. Each peptide was coupled to the Keyhole Limpet hemocyanin
(KLH) protein via an additional N- or C-terminal cysteine residue and a
maleimidocaproyl-N-hydroxysuccinimide linker and used to raise antibodies in
sheep
(lnvitrogen, USA). The conjugated peptides (200 pg) were injected
intradermally (ID)
into sheep (1-3 yr age) in Complete Freund's Adjuvant (CFA) at 10-15 sites on
day 0,
and secondary boosters in CFA were given on day 14. Six ID injections of 200
pg KLH-
peptide in Incomplete Freund's Adjuvant at 10-15 sites were given at days 28,
56, 70,
84, 98 and 112. Test bleeds (2-5 ml) were taken on days 42, 56, 84, and 112
for ELISA
analyses.
Antibody titer was determined with an ELISA with Peptide-GGG (goat gamma
globulin)
bound in solid phase (0.1 pg/100 p1/well) on high binding 96 well plates. The
serum was
first diluted 50-fold and then further diluted in 2-fold serial dilutions. The
ELISA titer is
the estimated dilution factor that resulted in an OD405nm of 0.2 and is
derived from
nonlinear regression analysis of the serial dilution curve. Detection was
obtained using
an HRP (horseradish peroxidase)-conjugated secondary antibody and ABTS (2,2'-
azino-bis(3-ethylbenzthiazoline-6-sulphonic acid). In the antibody-binding
experiment
M1 cells (40 pl of cells in 2 ml of sodium carbonate buffer) were immobilised
on
Maxisorp ELISA plates and antibody binding was determined by ELISA. Serum
samples were diluted 1/20 in diluent (1% w/v casein in PBS Tween 20 (g/I NaCI,
8.0;
= KCI, 0.2; Na2HPO4, 1.15; KH2PO4, 0.2; pH 7.2-7.4; Tween 20, 0.5 ml) and
incubated
at room temperature for 1 hr. Plates were washed 6 times with PBS Tween 20 and
conjugate (donkey anti-sheep/goat IgG HRP, 50 p1/well of a 1/5000 diluted
solution) and
substrate (3, 3',5, 5' tetramethyl benzidine, 50 pl/well) were added. After
incubation at
room temperature in the dark for 15 min, stop solution (50 p1/well of 0.05 M
H2SO4)
was added and 0D450 nm readings were taken.
Accession numbers and sequence listing
The nucleotide sequence of the M. ruminantium M1 chromosome has been deposited
in
GenBank under Accession Number CP001719. Microarray data has been submitted to
the Gene Expression Omnibus (GEO) in accordance with MIAME standards under GEO
Accession Number GSE18716. The specific M. ruminantium sequences are disclosed

CA 2772224 2017-03-13
87
herewith as a teit file (.txt) for the sequence listing.
EXAMPLE 2: Results
General genome characteristics
The genome sequence of M1 consists of a single 2.93 megabase (Mb) circular
chromosome, the assembly of which has been verified by pulsed-field gel
electrophoresis (Figure 6). The general features of the Ml genome compared to
other
genomes of species within the order Methanobacteriales are summarized in Table
1,
below, and Figure 10. M1 has the largest genome of the Methanobacteriales
sequenced to date. This increased genome size is due in part to a lower
overall coding
density, but also to a large number of genes encoding surface adhesin-like
proteins, thern
presence of a prophage, and a variety of genes unique to the M1 genome. M1
encodes _
2217 open reading frames (ORFs) and a functional classification of each ORE is
. presented in Table 9, below, and Figure 15. Genomes of the
Methanobacteriales
display a GC skew similar to bacterial chromosomes (Lobry, 1996) (Figure 2)
and an X-
shaped synteny pattern that is characteristic of moderately diverged genomes
(Figure
3). Analysis of potential horizontal gene transfer (HGT) events in M1
identified a number
of genes which show high sequence similarity to non-methanogens, typically
from
members of the bacterial phylum Firmicutes (Table 4, below, and Figure 16).
These
potential HOT events can be visualized .in a BLAST heat map analysis (Figure
16).
Several approaches were used to define potential gene targets for. CH4
mitigation from
Ml. An integral part of this process was the analysis of genes Which are
conserved
across methanogen genomes (Figure 13 and Table 8, below). Coupled with this,
chemogenomic targets (Figure la) were selected on the basis of detailed
metabolic
analysis (Table 2, below), while potential vaccine targets (Figure 1 b) were
chosen from
proteins predicted to be associated with the M1 cell surface. Examination of
the M1
genome has revealed a number of features and targets that could lead to an
effective
enteric methane mitigation technology, and these are discussed below.
= 30 Growth and methanogenesis
Many of the enzymes involved in the methanogenesis pathway are strongly
conserved
and found only among' methanogens, and therefore present good targets for CH4
mitigation technologies. Although this pathway has been well studied in
methanogens =
= =

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
88
from a range of other environments (Thauer et al., 2008), the M1 genome shows
for the
first time details of this pathway in a rumen methanogen. M1 can grow with
H2+CO2 and
formate (Smith & Hungate, 1958) and encodes the enzymes, and most of the
cofactors,
required for conversion of these substrates through to methane according to
the
metabolic scheme presented in Figure 11. Consistent with this hydrogenotrophic
lifestyle, M1 lacks the nnethanophenazine-reducing [Ni-Fe] hydrogenase
(VhoACG) and
methanophenazine-dependant heterodisulphide reductase (HdrDE) found in
methanophenazine-containing species within the order Methanosarcinales (Abken
et
al., 1998).
Surprisingly, M1 has two NADPH-dependent F420 dehydrogenase (npdG1, 2) genes
and
three NADP-dependent alcohol dehydrogenase (adh1, 2 and 3) genes. In some
methanogens, these enzymes allow growth on ethanol or isopropanol via NADP+-
dependent oxidation of the alcohol coupled to F420 reduction of methenyl-H4MPT
to
methyl-H4MPT (Berk & Thauer, 1997) (Figure 11). M1 is reported as not being
able to
grow on ethanol or methanol (Smith & Hungate, 1958), although a ciliate-
associated M.
ruminantium-like isolate was able to use isopropanol to a limited degree but
data were
not presented (Tokura et al., 1999). Our attempts to grow M1 on alcohols
indicate that
ethanol and methanol stimulate growth in the presence of limiting amounts of
H2+CO2,
but they do not support growth when H2 is absent (Figure 14). M1 does not
contain
homologues of the mta genes known to be required for methanol utilization in
other
methanogens (Fricke et al., 2006). The adh genes may play a role in alcohol
metabolism but the mechanism is under assessment.
Hydrogenotrophic methanogens usually encode a methyl coenzyme reductase II
(mall
or mrt), an isoenzyme of the methyl CoM reductase I (mcrl) enzyme which is
differentially regulated during growth (Reeve et al., 1997) to mediate methane
formation
at high partial pressures of H2. Interestingly, M1 does not encode a mail
system. In the
rumen, methanogens depend on fermentative microbes to supply H2, usually at
very
low concentrations, and M1 appears to have adapted its lifestyle for growth at
low levels
of H2 using the mcrl system only.
To examine the expression of genes involved in methanogenesis, in the presence
of a
H2-forming rumen bacterium, M1 was grown in co-culture with Butyrivibrio
proteoclasticus B316 (Moon et al., 2008) in a medium containing xylan as the
sole

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
89
carbon source, and gene expression was analysed by microarrays.
Formylmethanofuran dehydrogenase (fwdA), methyl CoM reductase (mcrBCDG),
methyl viologen-reducing hydrogenase (mvhG), and H4MPT methyltransferase
(mtrABCH) were significantly up-regulated (>2 fold) in the co-culture compared
to the
monoculture of M1 grown with H2+CO2 (Table 5, below). .Interestingly, formate
utilisation (fdhAB) genes were also up-regulated, suggesting that formate
formed by B.
proteoclasticus was an important methanogenic substrate transferred during
this
syntrophic interaction.
Genes encoding enzymes in the methanogenesis pathway that are potential
targets are
highlighted in Figure 11. Several methanogenesis marker proteins found in
methanogen
genomes, with hypothetical function, were also included in the target list.
Many of the
enzyme subunit targets are predicted to be within the cell cytoplasm, and
therefore best
pursued via a chemogenomics approach (Figure 11). However, several, subunits
including those of the Aha, Eha, Ehb and Mtr enzyme complexes, are membrane-
located and may be suitable as vaccine targets. Mtr catalyses the transfer of
the methyl
, group from methyl-H4MPT to CoM and couples this to the efflux of Na +
ions (Reeve et
al., 1997). Three of the Mtr subunits (MtrEDC) are predicted to be membrane-
spanning
in M1 and in each of the membrane-spanning regions the transmembrane helices
have
peptide loops located outside the cell membrane. These loops are potential
antibody
binding sites. Synthetic peptides corresponding to the loop regions of lintif,
Mtti) and
MttC have been coupled to a carrier protein and used as antigens to vaccinate
sheep.
The resulting immune sera were shown to bind specifically to immobilized M1
_cells
(Figure 17), demonstrating the feasibility of such a peptide-directed reverse
vaccinology
approach.
Analysis of the M1 genome has helped explain the growth requirements of M1 for
acetate, 2-methylbutyrate and co-enzyme M (CoM) (Bryant et al., 1971). Acetate
is
required for cell carbon biosynthesis after activation to acetyl CoA (acs,
acsA), followed
by reductive carboxylation to pyruvate (porABCDEF, Table 9, below). Reductive
carboxylation of 2-methylbutyrate is probably the route for isoleucine
biosynthesis
(Robinson & Allison, 1969), as M1 lacks a gene encoding a homoserine kinase
needed ,
for the usual pathway from threonine (Table 9, below). Exogenously supplied
CoM is
essential for M1 growth as two genes needed in the CoM biosynthetic pathway,
=

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
phosphosulfolactate synthase (comA) and sulfopyruvate decarboxylase (comDE)
(Graham et al., 2002), are missing in M1 (Figure 11).
=
5 Cell envelope
The methanogen cell envelope serves as the interface between the organism and
its
rumen environment, and as such represents a key area for the identification of
vaccine
and drug targets. The main structural component of the cell envelope of M1
(Figure 12),
as with other Gram-positive methanogens, is pseudomurein. This is structurally
10 analogous, but chemically different, to peptidoglycan, which performs
the comparable
function in bacteria (K6nig et al., 1994). Bacterial peptidoglycan
biosynthesis has long
been a major target of antimicrobials but these compounds are largely
ineffective
against pseudomurein-containing cells (Kandler & Konig, 1998). The pathway for
pseudomurein biosynthesis and its primary structure have been proposed
(Kandler &
15 KOnig, 1998), but the enzymes involved have not been characterized. Our
genomic
analysis has identified several genes encoding enzymes likely to be involved
both in the
intracellular biosynthesis of the pseudomurein precursors and the processes
involved in
exporting and assembling these into the cell wall (Figure 5).
20 The original description of M. ruminantium reported the existence of a
capsule
surrounding the cells, and chemical analysis of the cell walls showed that
galactose and _
rhamnose together with lower amounts of glucose and rpannose were present in
addition to pseudomurein (Kandler & Konig, 1978; Kandler & Konig, 1985). The
cell
walls are also reported to contain high levels of phosphate, comparable to
that found in
25 bacterial cell walls containing teichoic acid (Kandler & KOnig, 1978).
M1 contains
homologs of genes involved in teichoic acid production in Gram positive
bacteria
(Bhaysar & Brown, 2006; Weidenmaier & Peschel, 2008) (Table 9, below),
suggesting
the presence of as-yet unidentified cell wall glycopolymers. Additionally,
several genes
are predicted to be involved in exopolysaccharide production, sialic acid
biosynthesis
30 and protein glycosylation (Table 9, below). The genome contains a
homolog of the
eukaryal oligosaccharyl transferase (mru0391), a membrane protein believed to
be
involved in glycosylating proteins translocated via the Sec pathway (Yurist-
Doutsch,
2008) (Figure 12). Glycoproteins derived from the cell wall of M1 have been
shown to be
highly immunogenic in sheep. The resulting antisera agglutinated M1 cells and
35 significantly reduced their ability to grow and produce methane in vitro
(Wedlock et al.,

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
91
in preparation). Overall, polysaccharides and glycosylated molecules are a
major
component of the M1 cell envelope, and their accessibility at the cell surface
make
these polymers viable methane mitigation targets.
Genomes of human gut methanogens encode large surface proteins that have
features
similar to bacterial (Fricke et al., 2006; Samuel et al., 2007) adhesins.
Similarly, M1 has
an array of large adhesin-like proteins, much greater in number than those
reported
from other gut methanogens (Table 1, below). In the co-culturing experiments
described
above, six M1 adhesin-like proteins were upregulated (Table 5, below), and
microscopic
examination showed co-aggregation of M1 and B. proteoclasticus cells (Figure
9). In
addition, immune sera produced by small peptides synthesized to correspond to
four
M1 adhesin-like proteins were shown to bind specifically to immobilized M1
cells (Figure
17). Identifying highly conserved methanogen-specific features of these
adhesin-like
proteins may present a pathway to vaccine development Sixty two adhesin-like
proteins are predicted to be extracellular and contain a cell-anchoring domain
(Figure
12). These proteins represent a significant component of the M1 cell envelope
(Table
3). The largest group of these (44) contain a conserved C-terminal domain (M1-
C,
Figure 4) with weak homology to a Big_1 domain (Pfam accession number PF02369)
which may be involved in attachment to the cell wall, possibly by interaction
with
pseudomurein or cell wall glycopolymers. Several of these proteins also
contain a
papain family cysteine protease domain (PF00112), and their role may be in the
turnover of pseudomurein cell walls.
A second group of 14 proteins is predicted to contain a C-terminal
transmembrane
domain, suggesting they are anchored in the cell membrane. Curiously, the
genome
contains one adhesin-like protein (mru2147) with a cell wall LPxTG-like
sorting motif
and three copies of a cell wall binding repeat (PF01473), both of which are
commonly
found in Gram-positive bacteria. There has only been one other report of a
LPxTG-
containing protein in a methanogen, the pseudomurein containing Methanopyrus
kandleri (Boekhorst et al., 2005). Our analysis of the M. smithii PS genome
revealed
the presence of two LPxTG containing proteins (msm0173 and msm0411). Such
proteins are covalently attached to the cell wall by membrane associated
transpeptidases, known as sortases. Sortase activity has been recognised as a
target
for anti-infective therapy in bacteria (Maresso & Schneewind, 2008) and a
sortase
(rnru1832) has been identified in the M1 genome.

CA 2772224 2017-03-13
92
=
Prophage
Phage exert a significant ecological impact on microbial populations in the
rumen, and
have been suggested as biocontrol agents for rumen methanogens (Klieve &
Hegarty,
1999). Ml has 70 ORFs (m6.10256-0325) over a 62 Kb GC-rich (39% G-FC content)
region of the genome that encode a prophage genome, designated cpmru. Based on
a
functional annotation, cpmn., is partitioned into, distinct modules encoding
integration,
DNA replication, DNA packaging, phage capsid, lysis and lysogenic functions
,(Attwood
et al., 2008). Within the lysis module, a gene encoding a putative lytic
enzyme,
endoisopeptidase PeiR (mru0320), was identified. Recombinant phage lytic
enzymes
have been used for controlling antibiotic-resistant bacterial pathogens
(Hermoso et al.,
2007), and a methanogen phage lytic enzyme may be a viable biocontrol option.
We
have confirmed the ability of recombinant PeiR to lyse MI cells in pure
culture (WO
09041831A1) (Figure 8). PeiR represents a novel enzyme, as it does not show
significant homology to any sequence currently in public databases. The
variety of
methanogen cell wall types means a combination of different lytic enzymes will
be
required for effective methanogen lysis in the rumen. However, the expression
of Pelf?
and demonstration of its' effectiveness against a major rumen methanogen is an
important step towards this goal. PeiR will also be useful in increasing the
permeability
of pseudomurein-containing cell walls of methanogens to aid development of
genetic
_ systems for performing gene knockouts to validate targets, while the
cpmru phage itself
might be useful as a genetic tool for M. ruminantium. The prophage has also
been
disclosed in detail in US 60/989,840 filed 22 November 2007, and in
PCT/2008/000248
filed 25 September 2008.
=
Non-ribosomal peptide synthetases
= An unforeseen and novel feature of M1 is the presence of two large
proteins (mru0068
and mru0351) showing the distinctive domain architecture of non-ribosomal
peptide
synthetases (NRPS) (Figure 7). To our knowledge, this is the first report of
NRPS genes
identified in an archaeal genome. HGT studies indicate that these genes may be
bacterial in origin (Table 4, below). NRPSs produce a wide variety of small
molecule

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
93
natural products that have biotechnological applications as peptide
antibiotics,
siderophores, immunosupressants or antitumor drugs (Amoutzias et al., 2008).
The
NRPS encoded by mru0068 is predicted to encode two modules, each containing
condensation, adenylation and thiolation domains. The presence of a
condensation
domain in the first module is often associated with NRPSs that make N-acylated
peptides (Fischbach and Walsh, 2006). The second module is followed by a
terminal
thioesterase domain which is thought to release the peptide from the final
thiolation
domain. Mru0068 is surrounded by genes that encode two serine phosphatases
(mru0066, mru0071), an anti-sigma factor antagonist (mru0067), and a MatE
efflux
family protein (mru0069), which are likely to be involved in environment
sensing,
= regulating NRPS expression and export of the NRP, respectively. Mru0068
displays full
= length protein alignment with a putative NRPS from Syntrophomonas wolfei
subsp.
wolfei strain Gottingen (Figure 18), a Gram-positive bacterium known to
participate in
syntrophic interactions with methanogens (McInerney et al., 1979).
The second NRPS gene (mru0351) contains 4 modules and a thioesterase domain.
Downstream of mru0351 is another MatE efflux family protein (mru0352),
presumably
involved in NRP export. A third, smaller cluster of genes located elsewhere in
the
genome (mru0513-0516) appear to encode NRPS-associated functions. This cluster
.includes a 4'-phosphopantetheinyl transferase (mru0514) which primes NRPSs by
adding a phosphopantetheinyl group to a conserved serine within the thiolation
domain,
an acyltransferase (rnru0512) possibly involved in NRP acylation, a serine
phosphatase
(mru0515), an anti-sigma factor antagonist (mru0513), and an anti-sigma
regulatory
factor serine/threonine protein kinase (mru0516) that may function in sensing
the
environment and NRPS regulation. Although the products of each NRPS are
unknown,
s an analysis of adenylation domain amino acid sequences predicts 10 residues
(boxed,
Figure 7) which are important for substrate binding and catalysis. HGT studies
indicate
that these genes may be bacterial in origin (Table 4).
Thus, several genes in M1 are possibly involved in sensing the environment,
and in the
regulation and transport of the NRP (Figure 7) and such genes are also present
in the
S. wolfei genome. Although the actual roles of these genes have not been
defined
conclusively, NRPs are known to contribute to microbial growth and ecological
interactions, thus may provide a means to manage methane emissions from
livestock.

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
94
Comparative genomics analysis
To functionally compare M. ruminantium to other methanogens, 25 publicly
accessible
complete and draft phase genome sequences were subjected to a Functional
Genome
Distribution (FGD) analysis (Altermann, submitted) (Figure 13). Together with
Methanobrevibater smitbii, Methonsphaera stadtmanae, and Methanothennobacter
thermoautotrophicus, M. ruminantium formed a functional cluster. Within this
cluster, a
large number of predicted genes were found to be conserved (low e-value cutoff
le-
100, Table 8, below). The majority of these conserved genes were classified
into core
biological categories, such as amino acid biosynthesis, cell cycle, central
carbon
metabolism, nucleic acid metabolism, protein fate and synthesis and purine and
pyrimidine biosynthesis. Similarly, genes involved in energy metabolism,
especially in =
the methanogenesis pathway were commonly shared within this functional
cluster.
Most notably, only one fourth of this gene set was found to be conserved when
compared with other functional clusters. A similar observation was found for
conserved
genes involved in the biosynthesis of vitamins and co-factors. 23 genes were
found to
be highly conserved within the M. ruminantium functional cluster, whereas only
two
genes involved in cobalamin and thimaine biosynthesis were shared with
methanogens
outside this cluster, respectively. It is also interesting to note that, apart
from
Methanopyrus kandleri, pseudomurein containing methanogens have been
functionally
grouped together in the M. ruminantium cluster. This is clearly reflected in
the 14 highly
conserved genes involved in pseudomurein and exopolysaccharide biosynthesis.
Outside this functional cluster Only one gene, a glucosamine-fructose-p-
phosphate
aminotransferase, GlmS2, was found to be conserved at this level.
While conserved gene sets cause functional clustering, strain or cluster-
specific genes
are responsible for differentiation. When compared to all other members of its
own
cluster, M. ruminantium was found to harbour 468 strain specific genes (high e-
value
cutoff le-10). While the vast majority (341 genes) was assigned to genes with
hypothetical or unknown functional categories, a significant number of genes
were
identified assigned to relevant biological functions. Mobile elements such a
transposases and prophage elements were identified as strain specific to M.
ruminantium. Strain-specific genes involved in the production of
exopolysaccharides
and cell surface proteins are likely to endow M. ruminantium with surface and
adhesion
properties distinctly different from other members of the M. ruminantium
functional

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
cluster. Similarly, ten unique transport systems were identified ranging from
generic
multidrug transporter to predicted pH homeostasis systems. Also 22 regulatory
proteins
(16 involved in protein interaction and five transcriptional regulators) were
detected.
When extending the search for strain specific genes outside its own functional
cluster,
5 the number of identified ORFs dropped down significantly. Only three
genes coding for
adhesion-like proteins and two genes involved in the production of
exopolysaccharides
(a sialyltransferase and a glycosyl transferase) were found to be M.
ruminantium
specific.
10 Comparing pseudomurein producers (PMP) to all other methanogens using a
relaxed
parameter set (low e-value cutoff le-60; high e-value cutoff le-10; mismatch
tolerance
2) revealed an interesting set of genes functionally specific to this subset.
A number of
genes involved in pseudomurein biosynthesis were identified to be functionally
specific
to PMPs. In addition, two genes coding for adhesion-like proteins, four genes
predicted
15 to be involved in exopolysaccharide production and one gene coding for a
poly-gamma-
glutamate biosynthesis protein, likely to be involved in capsule synthesis,
were found to
be cluster specific. These genes coding for cell surface structures represent
prime
targets for vaccination based methane mitigation strategies, as their gene
products are
likely to reflect unique structures with the potential to induce specific
antibodies.
20 Interestingly, a gene coding for the energy-converting hydrogenase A
subunit R was
found to be PMP specific (including M. thermoautotrophicus and M. kandlen).
This gene
product is involved in electron transfer by reducing a ferredoxin. The Eha/Ehb
complex
is already being targeted for the development of a methanogen vaccine (Figure
11).
25 Currently a bias exists for pseudomurein producing methanogen genomes. With
the
exception of Methanothermobacter thennoautotrophicus (isolated from sewage
sludge)
and Methanopyrus kandleti (isolated from a submarine hydrothermal vent) all
PMP
methanogens were isolated either from rumen, the gastrointestinal tract or
from faeces.
It stands to reason that these closely related ecological niches facilitate
common
30 .. lifestyle adaption events. Such an event was detected in the presence of
a highly
conserved bile salt hydrolase which is predicted to hydrolyse the amide
linkage
between the bile acid carboxyl group and the glycine or taurine amino group.
The
presence of a bile salt hydrolase explicitly implies that M. ruminantium (and
other rumen
methanogens) is well adapted for a passage from the rumen environment through
to the
35 gastrointestinal tract. Functionally conserved oxidative stress response
genes such as

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
96
rubredoxin rub1 further suggest a certain tolerance of methanogens to aerobic
environments and a life-cycle from oral intake, biological activity in rumen
and
gastrointestinal tract ecologies, excretion into the aerobic environment and a
subsequent ¨ potentially time limited ¨ waiting period for the next oral
intake event may
be proposed. How strictly anaerobic organisms such as methanogens survive
exposure
to high stress levels remains subject to further evaluation.
A recently published phylogenetic tree based on seven core enzymes (Miller,
2001)
deviates in part significantly from the functional clustering shown in Figure
13. Anderson
et al. propose three classes of methanogens, based on the resulting
phylogenetic
approximation. In contrast, the FGD analysis revealed the presence of only two
major
functional clusters which can each be split into further sub-clusters (Figure
13). Most
notably, Methanocorpusculum labreanum, Methanococcoides budonii and
Methanosaeta thennophila form a distinct functional cluster under the FGD
analysis
(Figure 13, sub-cluster 1.3) but are separated into Class II and Class III,
respectively,
based on the phylogenetic analysis. These differences clearly highlight the
importance
of whole genome analyses to address lifestyle adaptation processes (as
described
above) and genomic plasticity within a biotechnological context.
To investigate the broader phylogenetic placement of M. ruminantium and assess
the
potential level of horizontal gene transfer between archaea and archaea and
eubacteria, a Blast Heat Map analysis was performed based on the non-redundant
amino-acid database (Figure 16). Significant heat flares were detected within
archaea
for the genera of Methanococcus, and, to lesser degrees for Methanosarcina and
Thermococcus (Figure 16A). Surprisingly, considerable levels of high sequence
similarities were detected for the eubacterial genera of Clostridium and
Bacillus,
commonly found in ecological niches inhabited by M. ruminantium. These heat
flares
infer a profound level of shared and functionally similar gene sets and
fortify the notion
that genetic exchange between microbial domains is a common event, likely
driven by
lifestyle adaption forces. Analysing the relative quality of sequence
similarity levels
revealed a core set of genes commonly shared among phylogenetically diverse
methanogenic archaea (Figure 16B). Interestingly, individual heat flares of
other
archaea such as Halobacteria sharing highly conserved gene sets to M.
ruminantium
appear similar in shape than flares observed for Clostridium and Bacillus,
further
strengthening the model of genetic exchange between domains. Interestingly, a
more

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
97
detailed analysis of the M. ruminantium M1 ORFeome to bacterial sequences
highlighted a series of gene sets not commonly found in other
Methanobacteriales such
as genes involved in biotin and cobalamin biosynthesis (Table 8, below).
Based on these observations we conducted a differential Blast Analysis (DBA)
using the
non-redundant database and the 26 methanogen genomes as references. While a
DBA
analysis is more liberal than FGD, it is able to highlight gene products
present in at least
one methanogen genome comprising dbMethano but not present in any other
organism
(nr database) and vice versa. Therefore, gene sets found to be present, in
methanogens
but not in other microbes might represent prime targets for methane mitigation
strategies. Using a minimum DBA value of four, 117 gene targets were
identified to be
conserved between M. ruminantium and methanogens but not present in other
organisms. Notably, 21 genes predicted to be associated to the cell envelope
were
identified, including cell surface proteins and genes involved in
exopolysaccharide and
pseudomurein biosynthesis. One gene coding for a polysaccharide biosynthesis
protein
and two adhesion-like proteins were among the most prominent targets (DBA
value of -
6). All three genes are involved in cell-cell interaction and could represent
targets for
methanogen modulation. Interestingly, a single adhesion like protein was
identified near
the origin of DNA replication, conserved between M. ruminantium and other
organisms
but absent in methanogens (Figure 10).
Closest hits were found to Coprococcus eutactus (Acc: ZP_02205388.1, isolated
from
human faeces), Streptococcus sanguinis (Acc: YP_001036038.1, isolated from
human
dental plaque), Peptostreptococcus micros. (renamed as: Patvimonas micra, Acc:
ZP_02093886.1, isolated from human gut), Arcanobacterium pyogenes (Acc:
AA043108.1, commonly found on mucosal surfaces of livestock) and Bacillus
weihenstephanensis (Acc: YP_001647931.1, human pathogen). All of those
organisms
are able to interact with either animal or human hosts and it is tempting to
speculate
that this adhesion reflects a specific lifestyle adaptation of M. ruminantium
to the rumen
and, possibly, to the gastrointestinal tract environment. This clearly
strengthens the
previous hypothesis modelled on the Blast Heat Map proposing a significant
level of
genetic exchange between M. ruminantium and certain genera of Eubacteria.
Similarly,
two adjacent glycosylhydrolases of the GT2 family were found to be shared in a
similar
way. For both proteins, top Blast hits link to Clostridia and Bacilli while
their function
was associated to the transfer of sugar units to teichoic acids which in turn
are

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
98
covalently linked to the cell wall thus providing M. ruminantium with a
methanogen-
unique outer cell-surface structure.
Genes predicted to be Involved in hydrogen metabolism and methanogenesis such
as
the energy-converting hydrogenase B (Ehb) and the tungsten formylmethanofuran
dehydrogenase (Fwd) were found to be methanogen specific. Also, another gene
involved core functions, a Fibrillarin-like archaeal protein, commonly thought
to
participate in processing pre-ribosomal rRNA, was found to be methanogen
specific. =
This is interesting, as only methanogen genera were excluded from the non-
redundant
database, but not other archaea. Therefore, this gene might present an
opportunity to
target methanogens at an essential function. An in-depth analysis of the
presence/absence of this gene in the methanogen genomes revealed an
interesting
distribution pattern. With the exception of Methanospirillum hungatei members
of
functional cluster 4 (Figure 13) do not harbours this gene, while cluster 3
predominantly
features this archaeal gene, with the notable exception of Methanococcoides
burtonii,
Methanosaeta thermophila and Methanosphaera stadtmanaa It might be noteworthy,
that within methanogens this gene is either absent or present, creating a
highly
conserved target with low genetic drift. Although not universally conserved,
this gene
might offer the opportunity to specifically target the majority of cluster 3
methanogens,
thus including those of rumen origin, for methane mitigation strategies.
Identification of targets for methane mitigation
Several approaches were used to define potential gene targets from M1 for CH4
mitigation via chemogenomic and vaccine approaches (Figure 1). Genes suitable
as
chemogenomics targets were identified using a combination of metabolic
profiling,
review of the literature pertaining to the biochemistry and physiology of
methanogens,
and comparative genomics. The 33 candidate genes commonly identified by these
approaches are shown in Figure 1A. The full list of ORFs identified as
chemogenomic
targets by metabolic profiling of M1 and literature can be found in Table 5.
Comparative
studies were based on M1 and 26 complete and draft phase methanogen genome
sequences, using a functional genome distribution (FGD) analysis (Table 3,
Figure 13).
This analysis of whole genome gene conservation among methanogens showed that
M1 and other members of the Methanobacteriales formed a functional cluster
that
shared a large number of conserved genes predicted to be involved in core
biological
functions (low e-value cut-off 1e-100, Table 3). In addition, a differential
blast analysis

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
99
(DBA) was conducted using the non-redundant (nr) database and a methanogen
genome sequence database (dbMethano). The DBA analysis highlighted genes
present
in at least one methanogen genome within dbMethano but not present in any
other
organism within the nr database and vice versa (Figure 10), thus identifying
methanogen-specific genes. The majority of the 33 selected conserved and
methanogen-specific genes encode enzymes that fall within the energy
metabolism
category, mainly within the methanogenesis pathway (Table 9). This also
included
several methanogenesis marker proteins found in methanogen genomes, but
currently
without defined function. Most of these methanogenesis enzymes are located
within the
cell cytoplasm, and therefore have been tagged as key targets for inhibitor
discovery via
a chemogenomics approach (Figure 11).
The alternative approach of inducing the ruminant immune system to produce
salivary
antibodies against conserved features of rumen methanogens is an attractive
methane
mitigation strategy. The rumen epithelium is not immunologically active, and
rumen
contents do not contain complement proteins, therefore specific immune
responses in
the rumen do not occur. The effectiveness of a vaccination approach relies on
the
binding of salivary antibodies to methanogen surface features, which results
in their
=
inactivation or clearance from the rumen. Vaccines are typically composed of
proteins
=or polysaccharides derived from killed or attenuated whole cells or
components
presented on the outside of the cell such as flagella, capsules, cell walls,
fimbrae, or
secreted toxins. In the case of rumen methanogens, the primary vaccine targets
are
likely to be surface-exposed or membrane-associated proteins that are
conserved
among methanogens or archaeal species and which encode functions vital to
methanogen growth and survival in the rumen. In silk analysis of the M1
ORFeome
(all ORFs) identified an initial pool of 572.0RFs containing one or more
transmembrane
helices (TMH) or signal peptide (SP) indicating a cell membrane or cell
surface location
and therefore potential vaccine targets. Those ORFs with a top BLAST hit to a
non-
methanogen or with no homology to the nr database were removed from the
analysis,
as were transposase sequences (which are unlikely to represent good vaccine
targets),
while adhesin-like ORFs are dealt with separately above. This gave a new total
of 337
ORFs. Examination of the remaining 337 ORFs, assessing their predicted
function,
degree of conservation among methanogens and the nature of their transmembrane
structures, refined the list to 71 ORFs (Figure 1B). Heterologous expression
of
membrane proteins with more than 4 TMHs has been difficult in RV studies of
other

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
100
microbes (Vivona et al., 2008). Therefore, a cut-off of 4 THMs was applied to
define
two final groups: Group A with 47 ORFs with 4 or fewer TMHs suitable for
cloning and
heterologous expression studies; and Group B composed of 24 ORFs with more
than 4
TMHs more suitable for a synthetic peptide-directed vaccine approach.
The majority of vaccine targets identified above correspond to hypothetical
proteins of
unknown function. While these ORFs are presumed to be of value to M1, their
importance to M1 growth and survival in the rumen is not evident, and
therefore they
are of lower priority as vaccine candidates. Of the remaining ORFs, those
involved in.
energy metabolism are again prime vaccine candidates (Figure 11). Of
particular
interest is the Mtr enzyme complex, which catalyses the essential methanogen
function
= of transferring the methyl group from methyl-H4MPT to CoM, coupled to the
efflux of
Na + ions (Lienard et al., 1996). Three of the Mtr subunits (MtrEDC) are each
predicted
to have >4 membrane-spanning regions and, in each of the membrane-spanning
regions, the transmembrane helices have peptide loops located outside the cell
membrane. These loops are potential antibody binding sites. We synthesised
peptides
corresponding to the loop regions of MtrE, MtrD and Mtr C which were coupled
to a
carrier protein and then used as antigens to vaccinate sheep. The resulting
immune .
sera bound specifically to immobilized M1 cells (Figure 17), demonstrating the
feasibility
of such a peptide-directed RV approach.
Vaccine target identification results
TMHMM predicted 542 ORFs to contain one or more transmembrane (TM) domains,
243 of which are also predicted to contain a signal peptide (SP). A further 30
ORFs
were predicted to contain a signal peptide but no TM domain. This gave a total
pool of
572 ORFs as potential vaccine candidates for the M. ruminantium Ml genome.
Blast
analyses revealed ORFs that had a top blast hit to a non-methanogen or had no
homology to the NR database. These ORFs were removed from the analysis at this
point as were transposase sequences (which are unlikely to represent a good
vaccine
target) and adhesin-like ORFs which were dealt with separately. This gave a
new total
of 339 ORFs. Those genes which are presently only found in M. ruminantium M1
and
provide important information about rumen methanogens.
Methanogens are strict anaerobes and are thus present challenges for culturing
in vitro
and genetic techniques for validating both drug and vaccine targets
particularly the

=
CA 2772224 2017-03-13
101
=
Methanobacteria with their thick cell walls are still being established. As
such, a further
manual analysis of the 339 ORFs functions was undertaken re-examining their
functional annotation, their conservation among methanogens and the prediction
of their
transmembrane structures and subcellular location which refined the target
list to 71
ORFs which are presently specific to methanogens or archaea. Because-
expression
can be challenging for membrane proteins, a cut-off of four TM domains was
applied to
= expression studies of M. ruminantium M1 (multiple TMs can be indicative
of a surface
exposed protein, but conversely, they are known to impair heterologous
expression in
Escherichia coh) This resulted in a final two groups; Group A ¨47 vaccine
targets (less
than or equal to 4 TM) suitable for further cloning and expression studies and
Group B ¨
24 -vaccine targets (greater than 4 TM) more suitable for a synthetic peptide
directed
vaccine approach. The adhesinTlike ORFs were treated as a separate vaccine
target
list Vaccine targets have also be disclosed in detail in US 60/989,841 filed
22
November 2007, and in PCT/2008/000249 filed 25 September 2008.
EXAMPLE 3: Overview
Genome sequencing
Methanobrevibacter ruminantium was chosen for genome sequencing because of its
prevalence in the rumen under a variety of dietary conditions (based on
cultivation and
molecular detection data), the availability of cultures, its amenity to
routine growth in the
laboratory, and the relatively large amount of previous studies and background
literature
available for this organism. A significant number of the genes within the M.
ruminantium
have been assigned a function, and have thereby allowed a detailed picture of
this
organism's lifestyle within the rumen. M. ruminantium's dependence on simple
substrates (H2 + CO2, formate) and its interaction with the rumen environment
via
surface proteins and exopolysaccharides are important targets for inhibition.
Similarly,
the SPIDRs hold promise for both specific targeting of M. ruminantium and for
future
genetic manipulations to assist in determining gene function. The sequence
data
elucidates the metabolism of this organism and how it interacts with other
microbes,
and points to conserved systems and components among methanogens that can be
inactivated to prevent or reduce methane formation in the rumen.

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
102
Drug discovery for reducing rumen methane emissions
The completion of the M. ruminantium genome now enables the full power of `-
omic'
approaches to be used for developing novel drugs for reducing methane
emissions. A
rational drug discovery approach to the development of effective methane
mitigation
agents, analogous to the established approaches utilised for developing novel
antibiotics against human pathogens, should proceed through several stages
including:
target identification; target/pathway validation; lead identification;
verification of
effectiveness of lead in rumen-like conditions; and ultimately, testing in
animal trials
(Gerdes et al. 2006; Pucci 2006; Galperin 2007). A priori, it is important to
know the
breadth of methanogen diversity in the rumen, and this has recently been
summarised
in a meta-analysis incorporating data from 14 phylogenetic studies (Janssen
and Kirs,
2008). The study has shown that the vast majority of rumen archaea (92.3%)
fall into
three clades, the genera Methanobrevibacter (61.6%) and Methanomicrobium
(14.9%)
and an uncultured group termed rumen cluster C (15.8%) of as yet unknown
physiology
(Janssen and Kirs, 2008). Methanogens typically only account for approximately
1-4%
of the total microbial community (Janssen and Kirs 2008).
Inter-genome comparisons of representative organisms, including relevant gut
methanogens (e.g., Methanobrevibacter smith!!, Methanospirillim hungatei and
Methanosphaera stadtmanae), other rumen microorganisms (bacterial, fungal and
prozoal) and mammals can aid in the identification of suitable targets (Samuel
et al.
2007; Fricke et al. 2006). Overall, rumen methanogens should be somewhat
easier to
inhibit than bacteria, fungi or protozoa given that they are the only resident
archaea in
the rumen and are well known to possess several unique traits including
distinctive
cofactors, cell wall chemistries and lipids. Furthermore, they tend to have
smaller
genomes with less metabolic capability, tend to be less adaptable with fewer
regulatory
systems and are probably less able to develop resistance to drugs.
Given the diversity of methanogens in the rumen, the aim of developing a full
spectrum ,
anti-methanogen 'magic bullet' for complete mitigation of emissions would
necessitate
the targeting of enzymes that are essential to all rumen methanogens under
normal
rumen growth conditions. However, partial inhibition may-also be desirable for
extended
periods of time, due to the potential decrease in the efficiency of feed
conversion
resulting from feedback inhibition of ruminal fermentation (Hegarty 1999;
Russell and
Rychlik, 2005). Significant partial reductions in methane emissions which
might be more

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
103
sustainable could also possibly be achievable by limiting the targeting to
specific
phylogenetic groups, such as the dominant Methanobrevibacteria. Methanogens
grow
slowly compared to rumen bacteria and are prone to being flushed out of the
rumen
(Janssen and Kirs 2008).
Analysis of the M. ruminantium genome, combined with the genome comparison and
a
consideration of the literature that has identified archaeal/methanogen-
specific enzymes
or has demonstrated the essentiality of enzymes/pathways has allowed us to
generate
a list of targets of interest (Tables 2 and 3, below). General targets areas
include the
methanogenesis pathway, energy metabolism, transcription, protein synthesis,
cell wall
synthesis, lipid synthesis, cofactor synthesis, and some key central carbon
metabolic
enzymes that are important links between essential pathways. Target
prioritisation for
introducing enzymes into the work stream is based on the ultimate aim of
obtaining
enzymes for high-throughput screening and crystal structure determinations for
in silico
lead identification. Targets are spread over multiple susceptible pathways to
minimise
risk. Prioritisation takes into consideration the presumed essentiality of
target, the
expected ease of expression of the proteins (e.g., size, number of subunits
and
presence of transmembrane domains), availability of assays, expected
`druggability'
and availability crystal structures of homologous enzymes (Pucci, 2006;
Hopkins and
Groom, 2002).
There are several factors relevant to the development of future small molecule
inhibitors
of methanogens. These include that they should have minimal toxicity to the
host
animals, minimal accumulation or toxicity in any downstream products for human
consumption, minimal deleterious effects on beneficial microorganisms
responsible for
normal fermentation in the rumen, and minimal downstream environmental impact.
Ideally, they should also be inexpensive, given the current cost of carbon, be
impervious to the large hydrolytic capacity of the rumen and should have
reduced
potential for allowing resistance to develop amongst the rumen nnethanogens.
In the
best circumstances, the concentration of inhibitor required should be low
enough to
prevent any rumen microbes from utilising the inhibitor as a substrate for
growth and
minimise overall costs (Weimer, 1998). It would be very beneficial if future
anti-
methanogen compounds that satisfy the above criteria can also help to reduce
methane
emissions emanating from other sources such as rice paddies. The goal of
providing
long term reductions in rumen methane emissions over decades will likely
require a

104
suite of non over-lapping anti-methanogen compounds. Compounds that are shown
to
. inhibit an enzyme in an in vitro high-throughput assay should sequentially
be verified for
their effectiveness in pure culture experiments, followed by in vitro rumen
simulations,
and finally in short term and long term animal trials.
In the last decade there has been growing concern, as evidenced by recent EU
legislation banning their use (McAllister and Newbold, 2008), about the use of
antibiotics and other feed additives as growth promoters largely due to the
development
of antibiotic resistance. Consequently, even though methanogens are usually
not
thought to be directly implicated as a causative agent in pathogenic disease
(Macario
and Macario, 2008), it may be wise to avoid over-reliance on anti-methanogen
agents
that seek to inhibit enzymes that are common between them such as those in
pseudomurein and peptidoglycan synthesis. Significantly, approximately two-
thirds of
antibiotics in use today against pathogenic microorganisms target cell wall
synthesis,
many of these the transpeptidation reaction catalysing the closure of
bacterial
peptidoglycan, but enzymes that catalyse earlier steps are being increasingly
investigated as alternatives (Hammes et al. 1979). One of the main reasons for
this is
that the final steps of cell wall synthesis occurs extracellularly and are
therefore the
drugs are less prone to inactivation.
The recent development of an anti-Mycobacterium tuberculosis drug that targets
the E
= subunit of the FoFi-ATPase that is also present in humans highlights the
fact that even
relatively small differences in structure could possibly be exploited to
discover novel
anti-methanogen compounds (Andries et at. 2005). The implication of this
finding is that
many essential methanogen enzymes that are not methanogen-specific. Targets
that
share <30-40% identity with their bacterial or eukaryal counterparts could
ultimately be
exploited for designing effective inhibitors.
=
, The number of enzymes or pathways in methanogens demonstrated to be
essential to
help guide prioritisation of targets is relatively limited. Historically, the
methanogenesis
pathway itself has been targeted in numerous experiments using halogenated
compounds such as chloroform that inhibit the terminal step of methanogenesis
catalysed by methyl coenzyme M reductase, but these are not sustainable due to
=
toxicity and environmental concerns.
=
CA 2772224 2018-05-04

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
105
In only a couple of other cases has a methanogen enzyme inhibitor been used to
check
whether rumen methanogen isolates hare also inhibited in pure culture, for
example the
targeting of the RFA-P synthase (Dumitru et al. 2003) and HMG CoA reductase
with
statins (Miller and Wolin, 2001). In addition, some additional understanding
of growth
characteristics of methanogens in the rumen may be needed. For example,
researchers
are still determining the extent to which rumen methanogens utilise amino
acids in the
rumen, which vitamins are used or enhance growth or the degree, if any, to
utilise
purines and pyrimidines. Thus at the moment, it may less desirable to target
enzymes
dedicated to the synthesis of amino acids, purines or pyrimidines.
The analysis of the M1 genome has provided new perspectives on the lifestyle
and
cellular processes of this prominent rumen methanogen. The genome sequence
confirms the hydrogenotrophic lifestyle of M1 and gene expression data
indicate that
= formate may be an important substrate for methanogenesis during
syntrophic
interaction with B. proteoclasticus. The ability of short chain alcohols to
stimulate growth
on H2 but not support growth themselves is intriguing. We speculate that
methanol or
ethanol are oxidised by the NADP-dependent alcohol dehydrogenases and the
reducing
= potential used to form F4201-12 using NADPH-dependent F420 dehydrogenase,
thus
augmenting the cellular pool of F420H2. This metabolism of alcohols could
spare some of
the H2 or formate normally used to produce F420112 and would explain the
stimulation of
- growth by alcohols in the presence of H2. The lack of a means of reducing
ferredoxins
with electrons from alcohols would explain why growth is not possible on
alcohols
alone. Further work will be required to test this hypothesis.
The abundance of genes encoding adhesin-like proteins in M1 indicates a
significant
ability to modulate cell surface topology. While the exact role of these
proteins is
currently unknown, initial observations from co-culture experiments indicate
that at least
some are involved in mediating close associations with hydrogen-producing
bacteria in
the rumen and others may be concerned with similar interactions with rumen
protozoa
and fungi.
The cpmru prophage sequence within the M1 genome yielded the PeiR enzyme which
is
able to lyse methanogen cells. The variety of methanogen cell wall types means
a
combination of different lytic enzymes would be required for effective
methanogen lysis
in the rumen. However, the expression of PeiR and demonstration of its
effectiveness

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
106
against a major rumen methanogen is an important step towards this goal. The
PeiR
enzyme and the pmru phage may also be useful in increasing the permeability of
M1
and other pseudomurein-containing methanogens to facilitate DNA entry and for
developing tools for genetic manipulation of Ml.
Methanogens are not known as producers of secondary metabolites, so the
discovery
of two NRPS genes was surprising, and to our knowledge, they are the first
reported in
an archaeal genome. Non-ribosomal peptides (NRPs) are known to contribute to
microbial growth and ecological interactions and therefore their function is
of interest as
they could lead to a means of modulating methanogen growth.
The metabolic profiling and comparative genomics carried out in this study
identified
several sets of conserved, methanogen-specific genes that are currently being
investigated further in our laboratory. Chemogenomic targets are being
investigated via
heterologous expression of genes in Escherichia colt coupled with the
development of
bioassays for screening these enzymes against libraries of chemical compounds
to find
specific inhibitors with efficacy at low concentrations. Vaccine candidate
proteins with
<4 TMHs are being investigated via heterologous expression in E. colt and
vaccination
of sheep. We have also shown the use of synthetic peptides in a reverse
vaccinology
approach to elicit specific antibody responses against M1 proteins with >4
TMHs. This
demonstrates that membrane-embedded M1 proteins, that are unlikely to be
amenable
to expression in a heterologous host, are viable targets as vaccine antigens.
A wider representation of rumen methanogen genomes will be essential to verify
that
the selected vaccine and chemogenomics targets are conserved among other rumen
methanogens, and ensure a successful, long-term CH4 mitigation technology for
rumen. The wealth of biological information 'provided by the M1 genome
represents a
significant advancement for ruminant methane mitigation efforts, aimed at
identifying
anti-methanogen technologies with broad efficacy.
EXAMPLE 4: Aik ATP synthase cloning and characterisation
We designed and developed an over-expression system for the Alk-ATPase from
Methanobrevibacter ruminantium and Methanobrevibacter smithii to allow the
subsequent purification and characterisation of the AiAo-ATPase.
=

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
107
Methanobrevibacter ruminantium and Methanobrevibacter smithii PCR cloning
and introduction of Hexa-His tag by PCR overlap extension
To study the biochemical properties of the M. ruminantium Al-ATPase, we
prepared
inverted membrane vesicles and tested for ATP hydrolysis activity. We were
unable to
detect any significant levels of ATP hydrolysis activity from inverted
membrane vesicles
of M. ruminantium. Due to the limited amount of cells that can be prepared at
any given
time for M. ruminant/urn, We undertook a heterologous over-expression approach
to
produce the ArATPase. For this, we cloned the M. ruminantium ArATPase genes as
a
6.3 kb BamH1-Xbal PCR product into the expression vector pTrc99a, generating
plasmid pTrMbrA1. To insert the HIS-tag at the N-terminal of Subunit-A PCR
overlap
extension was conducted. Using this approach, we generated a clone named
pTrMbrA1HIS which contains the genes encoding for the M. ruminantium ArATPase
in
the E. coil expression vector pTrc99a, and introduced a Hexa-Histidine tag
onto the N-
terminal of Subunit A. We also cloned the A. genes with the Al genes to
construct a full-
length AlA. ATP synthase expression plasmid. This was named pTrMbbrA1AoHis9.
In
addition, we cloned the ArATPase of Methanobrevibacter smithfi as a 6.3 kb PCR
product into the E. coil expression vector pTrc99a generating the plasmid
pTrMbsA1.
To facilitate purification, we introduced a Hexa-Histidine tag onto the N-
terminal of the
M. smithfi Subunit-A by PCR overlap extension. This was named pTrMbsA1HIS. The
lists of primers and plasmids from this study are shown below.
Primers
Primer Name Primer
Modifications
MbrA1FWD AAATTTGGATCCGGAATCTTAGGTTAGGAGGTCAAT
(BamHI)
SEQ ID NO: 7590
MbrA1REV AAATITTCTAGATAACAAGCAAAATATGAATTGC
(Xbal)
SEQ ID NO: 7591
MbrA1HisFWD ATGCATCATCATCATCATCATAGAGGAACTCAAATGTATGAA HEXA-HIS TAG
MbrA1HisREV ATGATGATGATGATGATGCATCCCATCTGCGACGATAACAGG HEXA-H IS TAG
MbrA1His_MID TTAGACAAGTTCTTAGTCGACTCTG (Sal)
MbrAO REV AGAGACAATTTTATCTGCCCCAGAGCTCAT (Sac)
= MbrA1FWD
ATTTAATTACCATGGTGATTTATTATGGCA (Nco)
MbrA1ASeq 1 ATTGCAGGTCCTGTTATCGTC
MbrA1ASeq2 GGACATTCCACTTATTACCGC
MbrA1ASeq3 ACTTATCCGAACCGGTTACTC

CA 02772224 2012-02-24
WO 2011/025394 .PCT/NZ2010/000169
108
SEQ ID NO: 7592-7599
MbsA1FWD AAATTTTAAGGATCCAATCTGTATGAGCTCAG BamHI
MbsA1REV AAATTTGTCGACCAATTACACAAAAAGATGAGCCGTTAC Sall
MbsA1HisFWD ATGATTCATCATCATCATCATCATATCGAAGGAAAAATTATTA HEXA-HIS TAG
MbsA1HisREV AA HEXA-HIS
TAG
MbsA1_AatIIRE ATGATGATGATGATGATGAATCATTTAACCATCTCTACCCCAA (Aat11)
V TA
MbsA1Seq1 ATTTATCCACATATGGACGTCCTTTCCTTA
MbsA1Seq2 CCTCTGAAGGATCATCTGAT
MbsA1Seq3 AGCATIGCTICTGAAGGTGAA
GAGTAAACACTATTGGTACTA
SEQ ID NO: 7600-7607
Plasmids
Plasmid Name Details Features
pIrMbrA1 Methanobrevibacter
ruminantium ArATPase cloned into
expression vector pTrc99a as a 6.3 kb Bam/Xba fragment
pTrMbrA1HIS
Methanobrevibacter ruminantium ArATPase, cloned into Hexa-His Tag
expression vector pTrc99a as a 6.3 kb Bann/Xba
= fragment. N-terminal Hexa-Histidine tag on Subunit A
pTrMbrA1A0
Methanobrevibacter ruminantium AiAo-ATPase cloned Hexa-His Tag
into expression vector pTrc99a as a Nco/Xba fragment.
N-terminal Hexa-Histidine tag on Subunit A
pTrMbsA1 Methanobrevibacter
smithii Al-ATPase cloned into
expression vector pTrc99a as a 6.3 kb Bam/Sal fragment
pTrMbsA1HIS _ Methanobrevibacter ArATPase cloned into
expression vector pTrc99a as a 6.3 kb Barn/Sal fragment. Hexa-His Tag
N-terminal Hexa-Histidine tag on Subunit A
Over-expression and purification of pTrMbrAl HIS, and pTrMbsAl HIS as analysed
by Western Blotting
As noted above, we generated a clone named pTriVlbrAl HIS which contains the
genes
encoding for the M. ruminantium Al-ATPase in the E. coil expression vector
pTrc99a,
and introduced a Hexa-Histidine tag onto the N-terminal of Subunit A. We
expressed
the plasmid pTrMbrA1HIS in the E. coil strain DK8, and purified the expressed
protein
complex by Ni-affinity chromatography. We were able to detect Subunit-A via
both
Western and MALDI-TOF/TOF analysis. Subunit-A was found to be running at an
incorrect molecular mass of approximately 24 kDa compared to the 65 kDa
predicted
molecular mass. We found that this discrepancy was caused by a mutation within

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
109 =
SubunitLA. This mutation has now been corrected, and we have repeated the over-
expression and purification with the new construct. Furthermore, we have also
created
a clone to express the full length A1A0-ATPase in E. coli. The purification
and
characterisation of the Alk-ATPase from M. ruminantium has proceeded
accordingly.
- From Western analysis of the M. smithii over-expression, two dominant bands
can be
observed. One protein band runs above the 72 kDa marker, and the other runs at
approximately 33 kDa. The expected size of the M. smithii Subunit-A is 64.8
kDa,
therefore the protein band running at approximately 72 kDa is likely the Mbb.
smithii
Subunit-A, and the lower band running at 33 kDa is likely a breakdown product,
or
unassembled Subunit-A which still retains the HIS-tag. We are proceeding to
further
purify the Ni-affinity eluted fractions, through either PEG-fractionation or
gel filtration
= with the aim to remove the lower contaminating band, while still
retaining Al-ATPase
activity. We have assayed the ATPase activity of the eluted M. smithii Al-
ATPase and
found the sample to hydrolyse with a specific activity of approximately 0.4
Units/mg.
Mbb. ruminantium AIA, ATP synthase expression in a foreign host
The Mbb. ruminantium Aik-ATPase was expressed in E. coil strains DK8 (Aatp),
BL21
and C41 (Figure 24A-D). All strains showed a decrease in growth after
induction of
expression with 1 nnM IPTG. BL21 showed the best growth (Figure 24A) and
expression
of the Alk-ATP synthase and therefore was chosen as a suitable expression host
for
subsequent purification. Growth of the induced cultures (BL21, C41 or DK8/
pIrMbbrA1A0His9) is at a reduced rate compared to the non-induced control
culture in
all 3 strains (see Figure 24A-C), a phenomenon that is a good indication of
foreign
protein over-expression in E co/i. To examine the localization of the
recombinant AlAo-
ATP synthase in E coil the cell debris, cytoplasm and membranes were examined
by
SDS-PAGE and immunoblotting. Purified FiFo-ATPase (his-tag on p-subunit) from
TA2.A1 enzyme was used as a positive control (Figure 24D). The enzyme was
localized
in the membranes and not in the cytoplasm indicating the presence of a
properly
assembled enzyme. pTrMbbrA1AõHis9 was able to be expressed in E. coli strains
BL21,
C41 or DK8, with the best growth and overexpression in BL21 (data not shown).
These
results also show the AlA0-ATP synthase is specifically localizing to the
membrane
preparation in both BL21 and DK8 cells.

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
110
Extraction of the AlAo-ATP synthase from cell membranes
The Mbb. ruminantium A1A0-ATPase was expressed in the E. coil DK8 (Aatp) and
BL21
(Figure 24A-D). Previously, we were able to solubilize the Mbb. ruminantium
AlA, using
2% DDM,_ and we are able to semi-purify the Mbb. ruminantium Alk ATP synthase
by
exploiting the introduced hexa-histidine tag on the A subunit (elution at 120
mM
imidazole, see Figure 25). However, solubilisation was considered limited with
only
about 40% of the tagged protein being extracted from membranes. Therefore, to
determine the detergent with the optimal solubilisation effect, E. colt BL21
inverted
membrane vesicles were diluted in solubilsation buffer supplemented with
different
detergents to concentrations of 0.5, 1,2 or 4%, and a concentration of 5 mg
protein/ml.
Solubilisation was performed under gentle stirring overnight at 4 C or at room
temperature with DM, DDM, Triton X-100, Cymal-6, CHAPS, cholate,
octylglucoside
and fos-choline. SDS was used as a positive control as it solubilized 100% of
the
membranes. The soluble and insoluble fractions were analyzed by SDS-PAGE and
immunoblotting. Comparison of the immunoblots revealed that fos-choline had
the best
solubilisation effect (90-100%), followed by DDM (40%), DM (35%) and cymal-6
(39%).
Triton X-100 and octylglucoside were weak (>20%). CHAPS and cholate led to a
significant degradation of the enzyme (a smear) and were therefore not
feasible.
However, after activity was measured of the solubilized membrane protein, the
best
detergent was DDM or cymal-6 both liberating 40% of the ATPase and maintaining
activity the highest activity. The Fos-choline samples did not contain enzyme
activity
regardless of concentration.
Purification of the Mbb. ruminantium A1A0-ATPase
BL21 containing pTrMbbrA1kHis9 induced with 1 mM IPTG and expression conducted
for 4 hours at 37 C. Membranes were prepared by French-press, and solubilized
with
2% DDM at 4 C overnight in the presence of 0.1% TCEP (a reductant). The
purification
was then routinely performed by IMAC and the bound protein subjected to 10,
20, 40
then 60 mM imidazole wash steps before elution at 100 mM imidazole. It should
be
noted that elution of a significant amount of Alk protein is observed at 60 mM
imidazole, however to ensure a very clean preparation this step was essential
to
remove contaminating proteins. To remove additional contaminants, the eluant
was
PEG-precipitated for 1 h at room temperature with 10 % PEG6000 followed by 15
%

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
111
=
PEGe000= The first step precipitation removed contaminating proteins (fraction
split), the
second precipitates the AlA, ATPase.
The purified Mbb. ruminantium AlAo-ATPase contained all 9 subunits, which was
confirmed by MS/MS (Figure 25A and B). The K-subunit appears both as a monomer
and as an oligomer on a 14% SDS-PAGE gel. When this enzyme preparation was TCA-
treated, the oligomers were no longer seen, and a strong band of the K monomer
was
observed. This observation is indicative of an SDS-stable K ring. This was
further
confirmed by isolation of monomers of the K-subunit by methanol/chloroform
extraction
(Figure 27). This K ring preparation is being used for antibody trials.
Purified Mbb. ruminantium AA, ATP synthase characterization
Two enzyme preparations were studied. Purified ATP synthase from BL21 and
recombinant enzyme expressed in E colt DK8 membranes. Purified Alk, ATP
synthase
was examined for ATPase activity using the inorganic phosphate assay. After
examining current literature on the Methanosarcina mazei and Methanococcus
jannaschii AiA, ATP synthases, it was decided to examine activity at 39 C and
a pH
value of 6.5 in a buffering system that mimics the Na + concentration in the
rumen (70-
137 mM Na).
To determine the kinetics of ATP hydrolysis, the reaction was started at 39 C
by
addition of Na2-ATP to a final concentration of 2.5 mM. 16 pg of protein was
used in
each end-point assay. Background ATPase activity generated by thermal
hydrolysis of -
ATP or contaminant ATP in buffer or enzyme was subtracted (these totalled <5 %
of the
final value shown; Figure 29A). The influence of Mg2+ on the kinetics of ATP
hydrolysis
was also evaluated. The reaction was started by addition of Tris-ATP to a
final
concentration of 2.5 mM. 16 pg of protein was used in each end-point assay.
Background ATPase activity generated by thermal hydrolysis of ATP or
contaminant
ATP in buffer or enzyme was subtracted (these totalled <5 % of the final value
shown;
Figure 29B).
ATPase activity was tested over a pH value range from 5.5 to 8.5 and in
presence and
absence of Na' using the purified recombinant AlAo-ATPase. The reaction was
started
at 39 C by addition of Na2-ATP or Tris-ATP to a final concentration of 2.5 mM.
16 pg of
protein was used in each end-point assay. Background ATPase activity generated
by

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
112
thermal hydrolysis of ATP or contaminant ATP in buffer or enzyme was
subtracted=
(these totalled <5 % of the final value shown; Figure 29C). The stability of
the purified
and membrane-bound (in DK8 membranes) Mbb. ruminantium A1A0 ATP synthase was
also tested. ATPase activity was examined each day after the preparation of
either
purified recombinant or DK8 membrane bound Mbb. ruminantium Alk ATP synthase.
The reaction was started at 39 C by addition of Na2-ATP to a final
concentration of 2.5
mM. 16 pg of purified protein or 0.5 mg inverted membrane vesicles was used in
each
end-point assay. Background ATPase activity generated by thermal hydrolysis of
ATP
or contaminant ATP in buffer or enzyme was subtracted (these totalled <5 % of
the final
value shown; Figure 29D).
To gain insight to whether the purified or membrane-bound Mbb. ruminantiumAr,
ATP
synthase is functionally coupled to an ionic driving force (F1+ or Nat),
tributylin (TBT)
was tested as an inhibitor. TBT is a well characterized F, and Ao channel
inhibitor of
ATP synthases. To examine the coupling ion used by the Mbb_ ruminantium Aik
ATP
. synthase, the effect of amiloride, a known Na-coupled V-type ATPase and
Na l" channel
inhibitor was also examined.
The effects of TBT and DCCD on ATPase activity were investigated as follows.
E. coil
DK8 (Aatp) inverted membranes containing the recombinant Aik-ATPase were used
to determine the effects of the inhibitors TBT (200 pM) and DCCD (250 pM) at
different
pH values. ATPase activity was measured in presence of 130 mM Na + (Figure
30A) and
in absence of Na + (Figure 30B). After preincubation with the inhibitor for 20
min at room
temperature (TBT or DCCD), the reaction was started at 39 C by addition of Na2-
ATP
or Tris-ATP to a final concentration of 2.5 mM. 0.5 mg inverted membrane
vesicles was
used in each end-point assay. Background ATPase activity generated by thermal
hydrolysis of ATP or contaminant ATP in buffer or enzyme has been subtracted
(these
totalled <5% of the final value shown; Figure 30A and 30B).
Tributylin inhibition of ATP hydrolysis by purified recombinant Mbb.
ruminantium
ATP synthase was then evaluated. After preincubation with the inhibitor
tributylin (TBT)
for 20 min at room temperature, the reaction was started at 39 C by addition
of Na2-
ATP to a final concentration of 2.5 mM. 16 pg of protein was used in each end-
point
assay. Background ATPase activity generated by thermal hydrolysis of ATP or
contaminant ATP in buffer or enzyme was subtracted (these totalled <5 % of the
final

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
113
value shown; Figure 30C). Amiloride inhibition of ATP hydrolysis of the Mbb.
ruminantium AlA, ATP synthase was evaluated next. After preincubation with the
inhibitor tributylin (TBT) for 20 min at room temperature, the reaction was
started at
39 C by addition of Na2-ATP to a final concentration of 2.5 mM. 16 pg of
protein was
used in each end-point assay. Background ATPase activity generated by thermal
hydrolysis of ATP or contaminant ATP in buffer or enzyme was subtracted (these
totalled <5 % of the final value shown; Figure 30D).
Tributylin inhibition of ATP hydrolysis by the Mbb. ruminantiumAo ATP synthase
was
also tested in 0K8 and native membranes. After preincubation with the
inhibitor
tributylin (TBT) for 20 min at room temperature, the reaction was started at
39 C by
addition of Na2-ATP to a final concentration of 2.5 mM. 0.5 mg inverted
membrane
vesicles was used in each end-point assay. Background ATPase activity
generated by
thermal hydrolysis of ATP or contaminant ATP in buffer or enzyme was
subtracted
(these totalled <5 % of the final value shown; Figure 31A). Amiloride
inhibition of ATP
hydrolysis of purified recombinant Mbb. ruminantium AlA, ATP synthase was
further
tested in DK8 and native membranes. After preincubation with the inhibitor
tributylin
_ (TBT) for 20 min at room temperature, the reaction was started at 39 C by
addition of
Na2-ATP to a final concentration of 2.5 mM. 0.5 mg inverted membrane vesicles
was
used, in each end-point assay. Background ATPase activity generated by thermal
hydrolysis of ATP or contaminant ATP in buffer or enzyme was subtracted (these
totalled <5 % of the final value shown; Figure 31B).
ATP synthesis in E. coil DK8 inverted membrane vesicles was further evaluated.
Time-
course of ATP synthesis was assessed at pH 6.5, 125 mM Na + and 39*C with 0.5
mg of
inverted membrane vesicles using the ATP synthesis inverted membrane vesicle
assay
using NADH as a driving force. Membranes were preincubated for 2 min with 2.5
mM
NADH with stirring before the reaction was initiated using 0.75 mM ADP and 2.5
mM P.
Closed squares with no DCCD; closed triangles, a 20 min preincubation with 250
pM
TBT (Figure 32).
Overview
We have successfully cloned, expressed and characterized the AlAo-ATP synthase
from Mbb. ruminantium. SDS-PAGE revealed 9 subunits and an SOS-stable K ring,
which was purified. The A1A0 synthase is active in both synthesis and
hydrolysis, but

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
114
the enzyme activities can be improved. This is consistent with other published
A1A0-
ATP synthases from methanogens. The coupling ion for the enzyme is being
identified
with studies suggesting both Fl+ and Na + ions being important. ATP hydrolysis
activity is
sensitive to TBT, DCCD, and amiloride in high concentrations, suggesting these
inhibitors will be ineffective against the growth of rnethanogens, hence the
need to find
a better inhibitor.
=
We will proceed to test antibodies generated towards the Alk-ATP synthase in
sheep
against the purified enzyme in a Western blot. The antibodies have been
directed
against the soluble Al part of the enzyme and therefore are probably
inaccessible
during growth inhibition studies. This suggests that targeting the A1 portion
will be
ineffective. We will also use the membrane-embedded sector (K ring) of the
enzyme for
new sheep antibody trials. This component would be accessible in the whole
cell, so
could be very useful as a target. We will also use the recombinant enzyme to
identify
inhibitors of activity using LOPAC1280Tm which is a versatile compound library
for
assay validation and high throughput screening.
EXAMPLE 5: Cloning and expression of non-ribosomal-peptide-synthase (NRPS)
genes
Experiments are being performed to obtain expression of full-length NRPS
genes,
.. isolate the expression product and submit for structural determination and
activity
testing. Two non-ribosomal peptide synthetase gene sequences have been
identified in
M. ruminantium M1 (Leahy et al., 2010). We have been able to clone and amplify
most
of the functional modules of the NRPS1 gene of M. ruminantium. This allows us
to
investigate the substrate specificity and mode-of-action of individual NRPS
domains.
We have also completed the design and in vitro assessment of predicted
synthetic
peptides from both the NRPS1 and NRPS2 gene products from M. ruminantium Ml.
The unexpected outcomes of these experiments (an opposed reaction to known
siderophores) has prompted significant interest in the nature of these NRPs
and their
native molecular structure.
We have shown the presence of the native NRPs in M. ruminantium M1 growth
supernatant, and are obtaining further information on secondary and tertiary
native
structures and on any further modification to the peptide backbone, such as
cyclisation

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
115
or acylation. Therefore, expression of full length NRPS genes in a
heterologous
expression system will give us an opportunity to purify the active peptide
compounds
synthesized and make the genes available for large scale production.
Suitable primer sets were designed to ensure full length amplification and
subsequent
cloning into suitable expression systems. We have obtained full length
amplification of
the M1 NRPS2 gene and are carrying out further experiments to clone this
amplicon
into a vector system. Small amounts of NRPS1 from M1 have been amplified and
inserted into entry vectors. These vectors are now being sequenced to confirm
that the
inserted amplicons reflect the NRPS gene and are free of non-silent nucleotide
mutations.
We are also synthesizing NRPS genes using GeneArt's gene optimization service.
This
optimization not only adapts codon usage to the heterologous expression host
E_ coil
but also accounts for factors that may compromise the stability of mRNA, such
as
extreme GC content, ribosomal binding sites, repeats and secondary structures_
Substrate feeding studies with E. coil crude extract and E. coil /I M.
ruminantium crude
extract mix will be carried out to evaluate the amount of functional NRPS
units.
Biological active NRP molecules will subsequently be detected using the CAS
colorimetric assay.
We are also working to induce gene expression by providing a range of stimuli
(i.e.,
increasing amounts of ion chelators) in the growth medium and monitor gene
expression levels. An alternative approach to isolate the non-ribosomal
peptides is to
identify induction conditions of the NRPS genes via Northern Blot analyses.
Induction of
those genes will lead to -increased mRNA levels, more active NRPS units and,
subsequently, more NRP molecules in the growth supernatant. Based on our
preliminary results reported earlier, we have identified two initial stress
conditions to
test. The interaction of NRP1 and 2 with Chrome Azure S (CAS) and Fe-ions,
make iron
scavengers and chelators such as Desferal and EDTA prime candidates for
initial
induction testing. The addition of both compounds to the growth medium may
trigger the
NRPS sensor system and cause elevated gene expression.
For these experiments, M. ruminantium M1 was grown to an 0D600 of 0.1 and then
aliquoted in 5 mL amounts into anaerobic tubes. Different concentrations of
EDTA and

CA 02772224 2012-02-24
_ WO 2011/025394 PCT/NZ2010/000169
116
Desferal were added to the cultures. Each culture was sampled at 1, 2, and 4
hours and
overnight after the addition of EDTA or Desferal. Samples were centrifuged to
pellet the
cells, supernatant was removed and the samples stored at -80 C. Subsequently,
total
RNA has been isolated and tested for integrity. To test semi-quantitatively
the level of
gene expression, RNA dilution series for each sampled time point and each
inducer
concentration will be established in a Northern Dot Blot system.
Three different probes have been designed targeting one house-keeping gene as
positive control, and both NRPS genes. We are currently in the process of
labelling
these probes and will commence testing. When appropriate induction conditions
have
been established, we will purify the native non-ribosomal peptides from M.
ruminantium
culture supernatant using , HPLC and assess for functionality using CAS
assays.
Furthermore, purified NRPs will be subjected to structural analyses were
possible. A
comparison between the non-ribosomal peptides from M. ruminantium and those
purified from the heterologous gene expression system will allow upscaling the
production of NRPs and derivatives thereof.
EXAMPLE 6: Vaccination of sheep using candidate proteins identified from the
M. ruminantium genome and other rumen methanogens
Experiments are being performed to use up to ten selected gene targets from
M. ruminantium for heterologous expression, vaccinate sheep and test resulting
serum
antibodies against methanogen cultures. The first step in identifying
candidate proteins
for vaccine development is to determine which M. ruminantium proteins are cell
surface-
located and potentially accessible to antibody binding. In silico analysis of
the M.
ruminantium M1 open reading frames (ORFs) identified an initial pool of 572
ORFs
containing one or more transmembrane helices (TMH) or signal peptide (SP)
indicating
a cell membrane or cell surface location. Those ORFs with a top BLAST hit to a
non-
methanogen or with no homology to the non-redundant database were removed and
adhesin-like ORFs were dealt with separately. This gave a new total of 337
ORFs.
Examination of the remaining 337 ORFs, assessing their predicted function,
degree of
conservation among methanogens and the nature of their transmembrane
structures,
refined the list to 71 ORFs (Leahy et al., 2010). Heterologous expression of
membrane
proteins with more than 4 TMHs has been difficult in reverse vaccinology
studies of
other microbes, so a cut-off of 4 THMs was applied to define two final groups:
Group A

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
117. =
with 47 ORFs with 4 or fewer TMHs suitable for cloning and heterologous
expression
studies; and Group B composed of 24 ORFs with more than 4 TMHs more suitable
for a
synthetic peptide-directed vaccine approach (see below).
M. ruminantium surface and membrane proteins selected as vaccine targets
Functional Category and Locus tag Annotation
Energy Metabolism
mru0697 AhaK
mru1405*, 1406*, 1407, 1408, 1411, 1412 EhaHGFEAB
mru2006, 2007, 2008, 2010, 2012, 2013 EhbIHGECB
mru1917, 1918, 1921*, 1922*, 1923* MtrGFCDE
Protein Fate
mru0239 SecG
mru0482 SecE
mru1234* type IV leader peptidase family protein
Vitamins & Cofactors
mru0540 CbiN1
Hypothetical
mru0542*, 0840*, 1693,2156*, 0233, 0234*,
0330, 1021, 1144, 1231, 1480*, 1585, 1635*,
1955, 2015*, 2046*, 2056, 2146* 0529 0081,
0196, 0225*, 0328*, 0412, 0428*, 0499, 0596,
0597, 0693, 0832, 1098, 1385, 0147, 0377*, Hypothetical proteins
1375*, 1641, 0543, 0833, 1991, 0545*, 0716*,
0718*, 0838, 0968, 1232, 1550, 1884*, 2202,
1694
* ORFs 5 TMHs
Many of these candidate genes correspond to proteins whose function is under
investigation. However, some are involved in energy production and are
therefore prime
candidates for vaccine development (Figure 11). Of particular interest are the
membrane-embedded ATP synthase enzyme complex which generates ATP from
either a sodium or proton gradient (Aha), the H4MPT methyl transferase enzyme
complex that catalyses the -second to last step in the methanogenesis pathway
(Mtr)
and two membrane-bound energy converting [Ni-Fe] hydrogenases (Eha and Ehb).
The HIMPT methyl transferase enzyme complex is the penultimate step in the
nnethanogenesis pathway. The methanogenic archaea use this pathway to generate
energy (Figure 11). The first five steps result in the sequential reduction of
CO2 by
electrons sourced from H2 to form N5-methyl-H4MPT, then the methyl group is
transferred to coenzyme M via the action of the methyl-H4MPT:CoM-
methyltransferase.

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
118
Mtr is made up of multiple enzyme subunits (Mtr E, D, C, B, A, F, G, H; Figure
33) and
couples the methyl transfer reaction to the efflux of Na + ions out of the
methanogen cell.
This creates a Na + gradient that is used, either directly, or via a Na+/H+
antiporter, to
drive ATP synthesis. Our analyses indicate that Mtr subunits are sufficiently
conserved
and specific to methanogens to be prime candidates for vaccine development.
Therefore we are sub-cloning and expressing these subunits in order to obtain
protein
to vaccinate into sheep.
In order to clone the genes into the pTrc99A vector, 2 pairs of primers were
designed
for each of the 9 target ORFs (8 individual subunits and complete operon-
mtrEDCBEFGH). One set of primers introduces a His (6 x Histidine) tag to the N-
terminal of the translated proteins, while the other set of primers do not
include this tag.
The primers were designed for insertion of the fragments between the Ncol site
and
Xbal site of the pTrc99A vector. Each open reading frame (ORF) from the mtr
operon
was amplified from M. ruminantium M1 genomic DNA, and ligated into the
appropriately
digested vector. The ligation, products were transformed into DH5a competent
cells
and insert-containing colonies were selected and analysed to verify insertion
of the
correct gene. In order to improve the chances of mtr gene expression, a codon-
optimised mtr construct was designed for synthesis by GENEART (Germany) and
cloned into pTrc99A. Each mtr gene contains an RBS site, an N-terminal 6 x His
tag, a
TEV protease cleavage site, and is flanked by unique restriction site
compatible with
sub-cloning individual synthetic ORFs into the pTrc99A.
The table below summarises the mtr gene cloning and expression results. All 9
ORFs
were successfully amplified with the two pairs of primers, giving 18
constructs, of which
17 were successfully cloned into the pTrc99A vector. All constructs were
sequenced to
confirm correct gene inserts.
Mtr cloning and expression
=
Constructs Cloned Sequenced Expression
mtrA -His Yes Yes In progress
mtr13-His Yes Yes In progress
mtrC-His Yes Y
mtnD-His Yes Yes progress
mtrE-His Yes Yes In progress
mtrF-His Yes Yes In progress
mtrG -His Yes Yes In progress
mtri-l-His Yes Yes Yes
mtrEDCBAFGH-His Yes Yes In progress

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
119
mtrA YesYes M Yes In progress
mtrBM Yes In progress
mfiC - Yes PI Yes In progress
mtrD - Yes Yes In progress
mtrE Yes M Yes In progress
mtrF Yes 1- Yes In progress
mtrG Yes Yes In progress
mt11-1 Yes - Yes -1-A Yes
Only the complete mtr operon without the 6 x His tag failed to clone from the
PCR
product. Expression of all 17 mtr constructs has been obtained using the
expression
host OverExpress C41 (DE3) (Lucigen) cells grown in YT medium and induced by
IPTG
at either 37.0 or 30.C. MtrH with or without the 6 x His tag was successfully
over-
expressed, and there also appeared to .be some mtrH expression from the
mtrEDCBAFGH-His construct (Figure 34).
. The MtrC construct with 6 x His tag had low level expression in the
OverExpress C43
(DE3) (Lucigen) expression host (Figure 35). After lysis of the cells
expressing the mtrH
and mtre proteins, the two proteins were solubilised and put through the
nickel columns
for purification, but the proteins did not bind well to the columns,
preventing column
purification. The codon-optimised mtr synthetic construct has also been tested
for
expression in OverExpress C43 (DE3) (Lucigen) cells in YT medium, and Rosetta
II
= (DE3), OverExpress C43 (DE3), OverExpress C41 (DE3), OverExpress C43
(DE3)
pLysS, OverExpress C41 (DE3) pLysS cells in auto-induction medium (ZYP5052).
No
expression from any of the mtr genes was detected under any of these
conditions.
Further expression of codon-optimised mtr synthetic construct in Rosetta!!
(DE3) and
induction temperature at 20 to 37 C for a range of induction times (4 to
16 hrs), with
IPTG concentration ranging from 0.1 mM to 1 mM is being assessed. We also plan
to
sub-clone each of the individual mtr subunits from the synthetic construct and
obtain
expression individually.
EXAMPLE 7: Vaccination of sheep using cell surface protein fractions isolated
from M. ruminantium cells
Traditional vaccine development against bacteria relies on using cell
fractions to elicit
antigenic responses in the host animal. This approach, while generally
accepted,
carries the inherent risk of contamination from other cell fractions. As an
alternative to
traditional cell fractionation, cell surface proteins isolated via non-
destructive treatment

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
120
are investigated for their ability to create effective and specific antigens.
Chaotropic
salts, such as guanidine hydrochloride, have been widely used to remove non-
covalently bound proteins such as S-layers from the cell surface, while
maintaining
viable microbial cells.
In our experiments, M. ruminantium M1 cells have been subjected to chaotropic
salt
treatment removing non-covalently bound proteins from the cell surface. In a
second
step the treated methanogen cells have been subjected to a trypsin digest.
This cleaved
off exposed protein epitopes from the cell surface, without disrupting the
cell wall or cell
membrane. For this protocol, M. ruminantium M1 cells were grown in RM02 media
for 7
days. The culture was then centrifuged to spin down the cells and the
supernatant
discarded. The cell pellet was washed three times in sterile distilled water,
resuspended
in 2 mL of 4M guanidine-HCI pH 7.0 and incubated at 37 C for 1 hour. The
suspension
was centrifuged in a microfuge at 13 000 rpm. The supernatant (containing non-
covalently bound surface proteins) was carefully removed and dialysed twice
against
100 mM ammonium bicarbarbonate buffer (pH 8). A sample was run on an SDS-PAGE
to estimate number and quantity of isolated proteins.
These samples have been used in a sheep vaccination trial. A Western blot
analysis of
M1 cell fractions against sheep antisera from the trial has been carried out
and a
significant level of cross-reaction has been observed (Figure 36).
A trypsin digest was then carried out for both the non-covalently bound
isolated proteins
and the exposed cell-surface epitopes. This digest also served to prepare the
samples
for subsequent MALDI-TOF analyses. Trypsin was added at an approximate ratio
of
1:50 relative to estimated amount of protein (based on SDS-PAGE). 10% (v/v)
HPLC
grade acetonitrile was added and the samples were incubated at 370 for 12
hours. The
digests were centrifuged, supernatants were collected and subsequently
dialysed
against 100 mM ammonium bicarbonate buffer (pH 8). Where appropriate, DTI"
(dithiothreitol) was added to a final concentration of 50 mM and the samples
were
incubated at 60 C for 30 minutes to reduce disulphides. IAM (iodoacetamide)
was then
added to a final concentration of 150 mM and samples were incubated in the
dark at
room temperature for 30 minutes. DTT and IAM were removed from the sample by
dialysis or washing with 100 mM ammonium bicarbonate buffer (pH 8). Both
preparations were sent to Dr Stefan Clerens (AgResearch, Lincoln) for MALDI-
TOF.

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
121
=
Protein fragments were subsequently compared to the non-redundant amino-acid
database hosted by NCB! and a custom ORFeome based M. ruminantium database
(Leahy et al., 2010), associating epitopes with their respective ORFs.
Six independent culture trials were conducted, including cells from normal
growth
conditions, cells from medium supplemented with methanol and cell subjected to
oxygen stress. A total of 57 fragments could be assigned to their respective
M.
= ruminantium M1 genes (see table, below). It is noteworthy that a
significant level of
variety in identified ORFs was encountered in between the individual protein
isolations.
This may be caused by a sensitive and rapid adaptation of M. ruminantium to
even
= small changes in culture conditions. Notable targets such as adhesion-
like proteins or
an ABC transporter substrate-binding protein were detected which will be
merged into
the priority target list. Interestingly, a number of cytosolic proteins (i.e.,
ribosomal
proteins and other predicted highly expressed genes) were also detected,
indicating a
certain amount of ongoing cell lysis during the sample preparation. In this
context, we
also identified the M1 bacteriophage (pmru integrase protein, pointing to a
continued
phage lysis process. This is supported by the detection of (pmru particle in
culture
supematant during normal growth conditions. The active prophage not only
points to a
highly stressed M. ruminantium cell condition but also may cause an altered
biochemical and phenotypical profile.
It therefore is important to improve culture conditions and also develop a
prophage-free
strain that lacks the potential of accelerated and uncontrolled cell lysis.
Consequently,
we have initiated a phage curing experiment which aims to create a phage-free.
M.
ruminantium derivative. Because M. ruminantium cannot be cultivated on solid
media
traditional phage curing methods cannot be employed. We have therefore opted
for an
evolutionary approach that uses ProteinaseK to remove free phage particles and
= continuous minimal subculturing. We will enrich for a prophage-free M.
ruminantium
population that eventually evolves in a fully cured derivative. This
derivative would then
also be used in further experiments, such as the assessment of the prophage
(pmru.
Most interestingly, we were also able to identify the M1 NRPS1 gene product,
indicating
that the NRPS system can be active and expressed under laboratory growth
conditions.

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
122
List of open reading frames identified by MALDI-TOF analyses.
ORF number , Annotation Count
82 Adhesin-like protein+ = 1
113 (1228) Exopolysaccharide
biosynthesis polyprenyl 1
glycosylphosphotransferase"
115 RadA DNA repair and recombination protein+ 1
117 HdrA CoB¨CoM heterodisulfide reductase subunit A'"** 7
201 ModA molybdate ABC transporter substrate-binding protein+ 1
205 Copper ion binding protein" 1
247 ThiC1 thiamine biosynthesis protein*** 7
256 Phage integrase*** 5
326 Adhesin-like protein*** 2 =
333 FdhA1*** 3
334 FdhB1"** 3
351 Nrps1+ 1
455 Acetyltransferase+ 1
481 FtsZ cell division protein-I- 1
498 Fbp fructose 1,6-bisphosphatase*** 3
520 Translation elongation factor aEF-1 beta+ 1
526 Hmd coenzyme F420-dependent N(5),N(10)- 5
methenyltetrahydromethanopterin reductase***
550 PorA pyruvate ferredoxin oxidoreductase alpha subunit*** 4
551 PorB pyruvate ferredoxin oxidoreductase beta subunit*** 2
569 Mer 5,10-methylenetetrahydromethanopterin reductase*** 7
582 PhoU phosphate uptake regulator PhoU*** 2
595 PurP+ = 1
629 Hypothetical protein+ 1
735 Rbr1+ 1
727 (2191) Adhesin-like protein
with cysteine protease domain" 1
774 Archaeal histone+ 1 -
816 HdrC CoB¨CoM heterodisulfide reductase subunit C*** 6
817 Hdr13*** 3
851 Rpl3p ribosomal protein L3P+ 1
872 Rps5p ribosomal protein S5P+ 1

CA 02772224 2012-02-24
WO 2011/025394
PCT/NZ2010/000169
123
949 BtcC bicarbonate ABC transporter substrate-binding protein***
8
1052 Transcriptional regulator+ 1
1091 SucD^ 2
1490 Ribosomal protein L7Ae+ 1
1228 (113) Hypothetical protein' 1
1371 Hypothetical protein+ 1
1491 Archaeal histone"" 8
1499 Adhesin-like protein with transglutaminase domain+ 1
1570 Acs, ADP-dependent acetyl-CoA synthetase"** 5
1645 Thermosome subunit*" 2
1683 Hypothetical protein"' 3
1686 Archaeal histone*** 2
1691 MoaA molybdenum cofactor biosynthesis protein+ = 1
1730 Heat shock protein Hsp20+ 1
1805 Translation elongation factor aEF-1 alpha*" 7
1836 Cell shape determining protein MreB/Mr1 family*** 3
1888 PycB+ 1
1897 PpsA1 phosphoenolpyruvate synthase+ 1
1900 Hypothetical protein+ 1
1901 Peptidyl-prolyl cis-trans isomerase+ 1
1906 MvhA methyl viologen-reducing hydrogenase alpha*** 7
1907 MvhG methyl viologen-reducing hydrogenase gamma*** 4
1916 _MtrH tetrahydromethanopterin S-methyltransferase*" 9
1919 MtrA1 tetrahydromethanopterin S-methyltransferase*** 4
1920 MtrB tetrahydromethanopterin S-methyltransferase+ 1
1921 MtrC tetrahydromethanopterin S-methyltransferase*** 2
1924 McrA methyl-coenzyme M reductase alpha subunit*" 5
1925 McrG methyl-coenzyme M reductase gamma subunit ** 12
1928 McrB methyl-coenzyme M reductase beta subunit*** 9
1993 CBS domain-containing protein+ 1
1994 CBS domain-containing protein"' 8
2022 Ftr2 formylmethanofuran-tetrahydromethanopterin
formyltransferase*" 7
2074 FdhA2 formate dehydrogenase alpha chain+ 1
2110 IlvC ketol-acid reductoisomerase+ 1

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
124
2121 Hcp hydroxylamine reductase*** 5
2131 Fae/Hps bifunctional formaldehyde-activating enzyme/3- hexulose-6-
1
phosphate synthase+
2142 Mtd F420-dependent methylenetetrahydromethanopterin 11
dehydrogenase*''
.2159 TrpB2 tryptophan synthase beta subunit ** 6
2191 (727) CD P-g lycerol:poly(g
lycerophosphate) glycerophosphotransferaseA 1
ORFnumber indicates the respective locus tag within the M. ruminantium M1
genome; Annotation shows
the corresponding functional annotation; Count highlights the number of
occurrences found for each ORF
throughout the six individual runs. ***: ORFs found multiple times, +: unique
hits, A: Hits with sequence
mismatch to M1 deduced aa sequences. ORF numbers in brackets indicate
ambiguous hits.
EXAMPLE 8: Expression and purification of enzymes from the methanogen
M. ruminantium for the discovery of inhibitors
Novel inhibitors have great potential to provide mitigation of the greenhouse
gas
methane from ruminants. This area of research has significance in the
stabilisation of
greenhouse gas concentrations in the atmosphere to prevent climate change. The
principal methane forming organisms in the rumen are archaea belonging to the
genus
Methanobrevibacter. We are targeting genes of rumen methanogens for cloning
and
expression in E. coil with the aim of obtaining purified enzymes that can be
used for:
.. high-throughput screening (HTS) assays of chemical compound libraries; and
in silico
screening of inhibitors. The majority of the targets are from five main
functional classes;,
methanogenesis/energy metabolism, central carbon metabolism, cofactor
synthesis,
cell wall synthesis and lipid synthesis. Work will continue to advance the
targets through
the pipeline. This project brings together diverse disciplines including
chemogenomics,
in silica modelling, structural biology, and the in vitro biological screening
of targeted
. compounds to formulate the development of potent anti-methanogen compounds
that
are non-toxic to host ruminant animals and have negligible environmental
impact.
Our aim is to discover small molecule inhibitors of methanogens, based on
genomics,
biochemistry, and structural biology. This is a powerful means to search for
inhibitors of
methanogens, which are difficult to culture and are not amenable to high-
throughput
screening with cells. In this study, a number of enzymes from
Methanobrevibacter
ruminantium were found to be solubly expressed in E. coli e.g. 3-hydroxy-3-
methylglutaryl-CoA reductase (HMGR),
methenyltetra hyd rometha no pterin
cyclohydrolase (MCH), 3-hexulose-6-phosphate isomerise (PHI) and bifunctional

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
125
formaldehyde-activating enzyme/3-hexulose-6-phosphate synthase (FAE/HPS). HMGR
catalyzes the rate-limiting step in the synthesis of isoprenoid units, which
are
components of archaeal membrane lipids. MCH is an enzyme involved in the
methanogenesis pathway. PHI and FAE/HPS are key enzymes of the ribulose
monophosphate pathway, used by methanogens to generate ribose for nucleotide
synthesis.
As a first step, we made a selection of targets. Information from literature
and genome
of Methanobrevibacter ruminant/urn (Leahy et. al., 2010) was studied and 34
targets
(see table in Example 9, below) were chosen. Next, we carried out cloning in
E. coll.
Genes were amplified and cloned into expression vector pET151D (Invitrogen).
Plasmids were used to transform E. coil BL21-Rosetta 2 cells (Novagen). From
this, 27
positive clones (see table, below) were obtained. We then looked for
expression of
recombinant proteins. Cells were grown in auto induction medium ZYP-5052
(Studier,
2005), with shaking at 25''6or 30 C for approx 16 hr. Cells were lysed using
lysozyme
at 4 C. The hexa-histidine-tagged enzymes were then purified from cell free
extracts by
nickel-affinity chromatography. Imidazole was removed and buffer was
exchanged. We
found 15 proteins were expressed while 10 (12) were soluble (see table,
below).
Clones that failed to express were grown in LB media induced with IPTG. Clones
with
insoluble expression were subjected to varying lysis conditions. To overcome
the lack of
expression in some clones, the genes have been synthesised for optimum
expression
in E. coil (GeneArt).
Biochemical characterisation of HMGR has also been carried out. This included
assays
to measure the oxidation of NADHP (366 nm, E 3,300 M-1 cm-1), which were
performed
at 37 C. Activity was expressed in U mg-1 of enzyme. One unit was defined as
the
turnover of one pmol of NADPH per minute (2 NADPH molecules are required to
reduce 1 HMG-CoA). Standard assays contained 50 mM BTP (Bis-Tris propane) pH
6.5, 400 mM NaCI, 0.05 mM DTT, 2.5% glycerol, 338 pM NADPH and 250 pM (R,S)-
HMG-CoA. Prior to use, the enzyme stock (0.6 mg/mL) was incubated in 400 mM
NaCl
and 10 mM DTT for 2 hours at 4 C and for 20 minutes at 37 C then kept on ice.
Assays were carried out in duplicate. HMGR was susceptible to oxidation and
could be
reactivated by incubation with 10 mM dithiothreitol for two hours. Highest
activity was
found at pH 6.5 and at 0.4-1.5 M NaCl. HMGR was able to oxidize NADPH but not
NADH. The enzyme had Km values of 165 35 and 12.4 1.83 pM for NADPH and

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
126
HMG-CoA, respectively. The statins simvastatin and lovastatin inhibit HMGR
with high
Kic values of 3.7 0.65 and 8.5 1.1 pM, respectively. Statins have
previously been
shown to inhibit the growth of strains of rumen Methanobrevibacter (Wolin and
Miller,
2006). Notably, structure-based alignment showed that the enzyme is a Class I
HMGR.
EXAMPLE 9: In silico modelling of enzymes from the methanogen
Methanobrevibacter ruminantium for the discovery of novel inhibitors
Analysis of the Methanobrevibacter ruminantium genome (Leahy et. al., 2010)
has
revealed archaeal and methanogen-specific enzyme pathways involved in methane
production, energy metabolism, protein, lipid, cofactor and cell wall
synthesis. Making
comprehensive use of this genomic data, essential protein targets have been
analysed
based on already available structural data of related enzymes for homology
modelling,
or when possible, purified protein has been submitted to protein
crystallisation trials for
x-ray structure determination.
The presence of published crystal structures that are similar in sequence is a
factor for -
selecting targets, due to the fact that they can be used to guide the
determination of our
own crystal structures, thus saving time. In addition, high-resolution
structures can also
be used as models to develop inhibitors, as is now being performed. For
example,
0Dcase (orotidine-5'-phosphate decarboxylase; PyrF) is a key enzyme in the
biosynthesis of the pyrimidine uridine-5'-monophosphate (UMP) (Nyce and White
1996). 0Dcase from other sources have provided crystal structures and high-
quality
work on developing inhibitors as part of its kinetic characterisation (Wu and
Pal, 2002;
Poduch et al., 2006; Poduch et al., 2008; Fujihashi et al., 2009; Bello et
al., 2007).
Other researchers are using 0Dcase for the development of novel anti-
pathogenic
compounds =based on small differences between the pathogen and mammalian
structures (Bello et al., 2007). There are over 40 crystal structures for
methanogen
0Dcases. Similarly, HMG CoA reductase from other sources has been identified
as the
presumed target of statins (Miller and Wolin, 2001). The work of Miller and
Wolin
validated HMG CoA reductase as a target in methanogens, and indeed, the entire
mevalonate pathway for lipid synthesis. There are >20 HMG CoA reductase
crystal
structures available.

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
127
The target sn-glycerol-1-phosphate dehydrogenase (NAD(P)-dependent glycerol-1-
phosphate dehydrogenase, EgsA) is a well known archaeal enzyme that forms the
stereo-specific glycerol-1-phosphate backbone for archaeal lipids (Koga and
Maui,
2007). GGPS (geranylgeranylphosphate= synthase) is another lipid synthesis
enzyme
that is being targeted as it also has an archaeal stereospecific catalytic
site (Koga and
Morii, 2007). A crystal structure is available for a methanogen GGPS (Payandeh
et at.
2006). As another example, DAPDC (diaminopimelate decarboxylase; LysA) helps
catalyse the formation of lysine which is a key cross-linking component of
M. ruminantium cell walls. Lysine is an essential amino acid in mammals and
therefore
the lysine biosynthesis pathway has been targeted for the development of novel
antibiotics (Hutton et al., 2007). A crystal structure is available for DAPDC
(Ray et al.,
2002).The methanopterin biosynthesis pathway enzyme RFA-P synthase has been
validated as a target in other systems, and a vast array of potential
inhibitors have been
identified (Dumitru et al., 2003; Dumitru and Ragsdale, 2004; Scott and
Rasche, 2002;
Miner et al., 2003). The methanopterin pathway enzyme CitG is presumed to be .
essential and is nearly-methanogen specific (Chistoserdova et al., 2003,
Chistoserdova
et at., 2004, Schneider et al., 2000). HisAF is also indicated to be part of
the
methanopterin pathway (Chistoserdova et al., 2003, 2004).
The F420 biosynthesis pathway includes the targets of CofA, PLT (CofD), CofC
(PLGT),
and creatinine amidohydrolase (CA) and FucA are nearly methanogen-specific and
presumed to be essential for methanogen survival (Graham and White 2002). Most
of
the remainder of the F420 pathway is also being targeted. A crystal structure
is
available for PLT (Forouhar et at. 2008). Several methanogenesis pathway
enzymes
are included which are encoded by single genes. These are essential for
survival and
there are crystal structures for all four (Hiromoto et al., 2009; Shinna et
al., 2008;
Grabarse et at., 1999; Aufhammer et at., 2005; Hegemeier et al., 2003). The
Coenzyme
M (CoM) pathway is also thought to be essential for survival and crystal
structures are
available for ComA and ComC (Irimia et al. 2004; Wise et al. 2003). The
Coenzyme B
biosynthesis pathway is the only methanogen cofactor pathway that is fully
methanogen-specific and should be absolutely essential (Graham and White,
2002).
Despite this, all the known enzymes (AksA, AksD, AksE and AksF) share
significant
homology with bacterial proteins, and three have some homology with mammalian
enzymes (AksD, AksE and AksF have some homology with mammalian aconitase
subunits and/or isocitrate dehydrogenase).
= =

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
128
The RuMP, or ribulose monophosphate pathway, is used by methanogens to
generate
ribose for nucleotide synthesis. Although it is not methanogen-specific it is
only found in
a very limited number of organisms and these are not typically found in the
rumen
(Werken et al., 2008; Growchowski and White, 2005). Several of the key enzymes
of
the pathway are of interest, and in M. ruminantium two of these are linked to
form a
bifunctional enzyme (HPS-FAE, formaldehyde-activating enzyme/hexulose-6-
phosphate
synthase). Phil (hexulose-6-phosphate isomerase) is also being targeted and is
also
part of the RuMP pathway. Interestingly, M. ruminantium also has another Phi
(Phi2),
although sequence analyses suggests that Phil is the more likely to be
involved in the
RuMP pathway. A methanogen crystal structure is available for Phi (Martinez-
Cruz et
al., 2002).
The targets Mur 53, 78, 520, 873 and 874 are murein ligases involved in
synthesising
the amino acid peptide linkages of the cell walls of members of the
Methanobacteriales.
Murein ligases are also found in bacteria. Disruption of cross-linking peptide
biosynthesis would be akin to discovering an 'anti-methanogen antibiotic' with
similar
effects to penicillin-like drugs (Zoeiby et al., 2003; Hartmann and Ktinig,
1990). Most of
these methanogen murein ligases (53, 520, 873 and 874) are quite distinct from
their
.. bacterial homologues, whereas Mur 78 retains quite high levels of homology
with its
bacterial counterparts. Interestingly, Mur 520 is also found in some
Methanococci and
Methanosarcina. Bacterial murein ligase structures (>40) are available that
could be
used as scaffolds for performing molecular replacement, thus aiding future
structure
determination of the methanogen enzymes.
Several enzymes are targeted as they are considered 'key' enzymes that are
central to
metabolism (gluconeogenesis that is required for amino acid, cell wall sugar
synthesis,
DNA and RNA synthesis and the TCA cycle), and therefore essential. Most of
these
have relatively easy spectrophotometric assays (Acs, PEP syn, AcsA,
SdhA/SdhB). Acs
and SdhA/B have archaeal-specific features (Bobik and Wolfe, 1989; Musfeldt
and
Schonheit, 2002). GatD and GatE are involved in translation and are archaeal-
specific
and provide glutaminyl-tRNA for protein synthesis (Possot et al. 1988). tRNA
synthetases have been successfully targeted for the development of novel
antibiotics
(Ahel et al. 2005). There is a methanogen crystal structure for GatD/E
(Oshikane et al.
2006).

CA 02772224 2012-02-24
WO 2011/025394 = PCT/NZ2010/000169
129
The current targets (see below) represent 12 different cellular processes or
metabolic
pathways with a large share (16 targets) being derived from methanogen
cofactor
synthesis pathways. Taking everything into consideration, methanogen cofactors
represent -strong targets overall as they are typically restricted to
methanogens, are
likely to be' essential and the cofactors themselves are fairly small
molecules.
Advantages of small molecules are that it can be easier to synthesise
substrates for
enzyme assays and easier to synthesise potential inhibitors that share similar
structural
features. Due to potential off-target effects, we have decided to avoid most
vitamin
synthesis pathways as almost all of the methanogen enzymes have counterparts
in =
bacteria and therefore, inhibitors would have a high chance of also inhibiting
beneficial
rumen bacteria. -
, Current chemogenomics targets
Target pathway PC R clone expressed/ Pure X-ta I comments
sokble
Nese (PyrF) pyrimidines no early target
HMG CoA red lipids yes yes yes/ yes yes yes early
target
sn-Gl P deh2 lipids yes yes no GA; early target
DAPDC (LysA) lysine/CW yes yes yes/ yes yes early
target
RFA-P (MptG) methanopterin yes yes yes/ no GA
PLT (CofD) F420 yes yes no GA
CofA(1093) F420 yes yes GA
. FucA F420 yes yes yes/ yes
Phil RuMP yes yes yes/ yes yes yes
Hmd methanogenesis yes yes no GA
Mch methanogenesis yes yes yes/ yes yes yes
=
-Mer methanogenesis yes yes yes/ no GA
Mtd methanogenesis yes yes GA
AksA Coenzyme B yes
AksD Coenzyme B yes yes, yes/ no
AksE Coenzyme B yes
AksF Coenzyme B yes yes no
CitG methanopterin yes yes yes/ yes
ComA (Homolog) coenzyme M yes yes yes/ yes
ComB (Homolog) coenzyme M yes yes no GA
ComC (Homolog) coenzyme M yes yes yes/ yes yes
ComD (Homolog) coenzyme M yes yes no = GA
ComE (Homolog) coenzyme M yes yes no GA
Hps-Fae = RuMP yes yes yes/ yes yes yes
Acs key-enzyme yes
AcsA key enzyme yes
PEP syn key enzyme yes yes yes/ yes
GGPS lipids - yes yes yes/
some
SdhA TCA yes
SdhB TCA yes
Mur 53 cell wall yes yes GA
Mur 78 cell wall yes yes . yes/ yes
some

130
Mur 520 cell wall yes yes
Mur 873 cell wall no . GA
Mur 874 cell wall no GA
GatD translation yes yes
GatE translation yes
CofC F420 no
CA F420/riboflavin no
HisAF methanopterin no
GA, gene synthesised by GeneArt and will be redoned; CA, creatinine
amidohydrolase
=
For specific experiments, in silico screening of large commercial compound
libraries
using the docking programme GOLD (Verdonk et. al., 2003; Cole, J.C. et. al.,
2005) has
formed the basis of our selection and design of high affinity ligands for our
modelled
proteins. Work is currently underway for evaluating the essential methanogen
enzyme
methyl-coenzyme M reductase (MCR), an enzyme that catalyzes the terminal step
in
methane production. A number of enzymes are being crystallised and include 3-
hydroxy-3-methylglutaryl-CoA reductase (HMGR), the rate-limiting step in the
synthesis
of isoprenoid units, which are components of archaeal membrane lipids. Others
include
3-hexulose-6-phosphate isomerase (PHI), a key enzyme of the ribulose
monophosphate pathway and methenyltetrahydromethanopterin cyclohydrolase
(Mch),
an enzyme involved in the methanogenesis pathway.
The programme GOLD (Verdonk et. al., 2003; Cole, J.C. et. al., 2005) has been
tasked
in carrying out the in silica docking process in order to obtain novel
inhibitors of
archaeal and methanogen-specific enzyrnes, in particular MCR (Grabarse et.
al.,- 2001;
Figure 37A). MCR has an a262y2 subunit structure which contains two nickel
porphinoid F430 rings which forms the centre of enzyme activity and two
molecules
each of methylcoenzyme M (CoM) and coenzyme B (CoB). These cofactors operate
under strictly anaerobic conditions to carry out the final reaction of the
energy
conserving pathway of methanogenic archaea in which CoM and CoB are converted
to
methane and the heterodisulfide product CoM-S-S-CoB (Figure 37B). This product
is
subsequently reduced with H2 back to the thiol forms of the separate cofactors
by
heterodisulfide reductase.
A number of structural databases from commercial suppliers have been
downloaded
from the ZINC (Irwin and Shoichet, 2005)
and screened with GOLD (Verdonk et. al., 2003; Cole, J.C. et. al., 2005).
Commercial
databases available from the zinc website such as Asinex, Chembridge building
blocks
and the LOPAC library of proven pharmacologically-active compounds were
screened
CA 2772224 2019-03-25

CA 02772224 2012-02-24
WO 2011/025394 PCT/NZ2010/000169
131
with MCR. Utilizing a ruminant model of MCR based on a crystal structure from
Methanothem7obacter marburgensis (pdb code 1 HBM4) active site regions were
subjected to specific and targeted docking attempts to find inhibitors that
could mimic
the natural substrates and product of the enzyme. The effectiveness of
candidate
inhibitors were then monitored in pure culture experiments. Cell density was
measured
over time to assess the effectiveness of potential inhibitors (Figure 38).
=
=

o
N)
,i
,1 =
IV
N) Table 1. Comparison of the M1 genome features with methanogens
from the order Methanobacteriales
iv
0. !77/1114tiirri iii0TitiiiiiiR M.
smithii PS M. smithii ALla M. smithii Fla
Methanothermobacter Methanosphaera
[34]
thennoautotrophicus AH stacitmanae MCB-3
0
,
ki)
1 Source ailElairikIi-;uviTeri1A Sewage digester Human
Human faeces Sewage sludge Human faeces
c)
w Project status MWeeiriii5let-eiWN
complete draft draft complete complete
1 Genome size (bp) .41.7.:21537:44203MNIVI
1,853,160 1,704,865 1,707,624 1,751,377 1,767,403
1.)
in G+C content (%) 6=4,0334_,Ata 31
31 31 50 28
Number of ORFs -;:tt; 7 ' )421,10. ' 61.':c; 1795 1709
1710 _ 1873 1534
Coding area (%) .M*,V8'4111Waiff 90 90 90
90 84
rRNA operons 2=PMEN 2 rid nd
2 4
_
tRNAs (with intron) i.-!_i::=31-'5ey(gp-,-,,,iz 34 (1) 34 34
39 (3) 40 (1)
Non-coding RNA "ft.-1,24a0.3Wg14".iiil 3 nd
nd 2 2
Insertion 1,-.7-7-4,-N,witqw-;-,tr ,-; 8 rid
nd 0 4
sequences _
Prophage ' MAZYide044041 Yes nd nd
No No
CRISPR regions Attt;Z.4-2V.AetViti. 1 rid nd
2 2
_
Adhesin-like wow, La - 48 nd nd
0 37 ¨
,
,
proteins
N)
_
; LPxTG motif iffAVASS1M.'K'= 2 nd
nd 0 0
_
Sortases wit-mm=4 1 nd nd
2 0
a Draft genome data obtained from National Centre for Biotechnology
Information ,
nd Data not determined from draft genome
34 Boekhorst et al., 2005
- 46 Smith et at. 1997
20 Fricke et al., 2006

'
-
' ,
-
C
w
o
Table 2. Potential chemogenomic gene targets of the M1 genome based on in-
mru1499 domain I--
1--,
depth literature.and metabolic analyses. mru1604
adhesin-like protein with transglutaminase --
o
'
Locus Annotation I Reference domain
(..3
(A
(.4
adhesin-like.protein with transglutaminase
AMINO ACID METABOLISM domain
i
adhesin-like protein with transglutaminase
domain
mru0997 phospho-2-dehydro-3-deoxyheptonate aldolase/ [S8,9]
fructose- bisphosphate aldolase mru1836 cell
shape determining protein MreB/Mrlfamily [S45-47]
mru0998 AroB [S9-11] mru1047 poly-
gamma-glutamate biosynthesis protein [S48,49]
= mru1577 AroA [S9,10,12]
mru2175 cell wall biosynthesis glycosyl transferase
mru1676 AroK [S13] mru0707 cell
wall biosynthesis protein Mur ligase family [S50-541
rnru0350 G1nA1 [S14] mrii1042 cell
wall biosynthesis protein Mur ligase family a
mru2078 G1nA2 mru1118 cell
wall biosynthesis protein Mur ligase family
o
mru1745 cell
wall biosynthesis protein Mur ligase family
mru0122 GlyA [S15-17]
IV
mru2091 cell
wall biosynthesis protein Mur ligase family -.3
mru2139 HisB [S18]
.-1
mru2092 cell
wall biosynthesis protein Mur ligase family NJ
mru0152 LysA [S19-21]
IV
mru0964 cell
wall biosynthesis protein phospho-N- [S55-57] IV
mru0153 DapF [S21,22]
acetylmuramoyl-pentapeptide-transferase family
mru1743 PdaD [S23, 241 mru1041 cell
wall biosynthesis protein phospho:N- i-4µ.3 .. "
o
'
mru0208 TrpE [S25]
acetylmuramoyl-pentapeptide-transferase family o.) H
IV
I
mru0410 11vB1 [S26, 27] mru2126 . cell
wall biosynthesis protein UDP- o
mru2112 11vB2
glycosyltransferase family = "
,
.
I
mru2111 IlvN mru1293 GlmS1
[S52, 58] "
mru1414 CimA [S28, 29] mru1536 GlmS2
mru1388 NAD
dependent epimerase/dehydratase [S59]
CELL CYCLE ' mru1413 NAD
dependent epimerase/dehydratase
mru0458 .GImM1
. [S52, 58]
mru0481 FtsZ [S30, 31] mru0449 GImM2
mru0240 PolD2 ' [S32] mru1733
phosphosugar-binding protein
mru2212 PolD1 mru2136
polysaccharide biosynthesis protein
n
.
mru1864 DNA topoisomerase VI subunit A [S33, 34] mru1470 GalE
[S59] 1-3
mru1865 DNA topoisomerase VI subunit B mru0456 G1mU
[S52, 58]
N
mru1005 UppS
[S60, 61]
= CELL ENVELOPE
mru2108 UppP [S52,62-64] o
1--,
o
mru1524
polysaccharide biosynthesis protein [S65]
mru0824 adhesin-like protein with transglutaminase
[S35- 44]
o
mru0828 domain CENTRAL CARBON
METABOLISM 1-,
o= .
mru1497 adhesin-like protein with transglutaminase
=

.
.
.
.
.
.
,
'
mru1434 AcsA [S66] , mru1408
EhaE
0
mru1570 Acs = .' TS66-68] mru1407 EhaF
= ,
(,..
mru0550mru PorA [S69-74]= mru1406 EhaG
c'
1¨,
0551 ' PorB mru1405
= EhaH = = 1¨
,
=. o
mru0549 PorD =
mru1404 Ehar
(A
mru0548 PorD mru1403 EhaJ
(.4
mru0552 PorE . mru1402
.EhaK
mru0553 PorF mru1401
= EhaL
, mru0957 RpiA [S75-77] mru1400 EhaM
mru1634 Prs [S78] mru1399 EhaN
mru0250 Phil [S75,77, 79- mru1398 = Eha0
.
mru1310 Phi2 81] mru1397 EhaP
.
mru2131 Fae/Hps . [S75-77,81, ,. mru1396
EhaQ .
mru1394 EhaR . = '
82]
mru1255 Mdh [S83-86] mru2014 EhbA
. [S108 110] a
mru2013 EhbB .
mru0847. PycA = [S87-901 =
0
mru2012 . EhbC = IV
mru1888 PycB
.-.1
mru201-1 EhbD
= mru0088 SdhA
[S91, 92] NJ
= ru
. m2010 EhbE = . IV
mru0655 = SdhB
' IV
' ' mru2009 ,
EhbF
mru2008 =EhbG NJ
ENERGY METABOLISM ' mru2007 EhbH
F. so 0
I-.
.
IV
' . mru2006 Ehbl
1
mru0701 AhaA [S93-105] ,mru2005
EhbJ o
n)
mru0702 AhaB mru2004 EhbK
. N31
mru0699 AhaC = mru2003
. EhbL .. .1,
.mru0703 AhaD mru2002 EhbM
=
mru0698 AhaE mru2001 EhbN
mru0700 AhaF = = mru2000
Ehb0
. .
mru0695 ' AhaH . = = mru1999 =
EhbP
mru0696 Ahal " nnru1998
EhbQ
mru0697 AhaK
.
= . mru1906
MyhA [S111-113]
, mru2064 FrhA .. [S106, 107] mru1905 MvhB
00
. mru2061 . FrhB1 ' mru1908
MvhD1 . n
1-
nnru2081 FrhB2 mru2076
MvhD2 -
mru2063 FrhD = . mru1907
MyhG - N
mru2062 FrhG mru0569 =
Mer = . . [S106, 114-
1--,
mru1412 EhaA [S108, 1091
= 116] c'
= .j(E3 mru1411
EhaB mru0117 HdrA . = ' [S106, 115,
o
mru1410 EhaC mru0817
' HdrB 117-122] 1..,
= c7,
mru1409 EhaD mru1212
HdrB2
.
.

_
mru0816 HdrC
1691 0
mru0526 Hmd [S106, 123- mru1092 HmgA
[S170-175] w
o
127] mru1640
hydroxymethylglutaryl-CoA synthase [S169, 172, 1--
1--,
mru2142 Mtd [S126, 128-
173, 176, 177] --.
o
131] mru0922 Fni
[S77, 176, k..i
uri
c..i
mru1393 Ftr1 [S106,115-
178-180]
mru2022 Ftr2 116, 132-133] .
mru0921 isopentenyl diphosphate kinase [S77, 181]
mru1619 Mch [S106, 114, mru0920 Mvk
[S170-175]
115, 129, mru0919
phosphomevalonate decarboxylase [S77]
134-136] mru1102
digeranylgeranylglyc,eryl phosphate synthase [S182]
mru1924 McrA . [S106, 114, mru0924 IdsA
[S177]
mru1928 McrB 115,137-151]
mru1926 McrC MOBILE ELEMENTS
. mru1927 McrD
a
mru1925 McrG
mru0317 phage-
related protein [S35]
mru1262 AtwA1
0
i 0320 mru
endosopeptidase PeiR [S171] n)
mru1850 AtwA2
...3
mru1919 MtrA1 . [S106, 115,
.-.1
NJ
mru0441 MtrA2 121, 152-155] PROTEIN FATE
IV
1\)
mru1920 MtrB
.1,.
mru1921 MtrC mru2021
transglutaminase domain-containing protein [S35]
c.,.)
0
mru1922 MtrD mru0391
oligosaccharyl transferase cn H
IV
mru1923 MtrE mru1832
sortase family protein [S183, 184] 1
o
mru1918 MtrF
"
1
mru1917 MtrG PROTEIN SYNTHESIS
.1,
mru1916 MtrH mru2169 GatA
[S185-189]
mru0344 FwdA S121, 156- mru2029 GatB
mru0343 FwdB 162] mru1142 GatC
mru0345 FwdC mru1571 CysS
[S185, 186,
mru0342 FwdD
190]
mru0254 FwdE mru1427 GatD
[S185-187,
mru0340 FwdF . mru1426 GatE
" 191-193]
mru0341 FwdG = mru0126 IleS
[S186, 194- n
1-
mru0339 FwdH
196] ,
mru0242 LysS
[S185-187] N
LIPID METABOLISM mru0954 ProS
[S197, 198]
1--,
mru1947 SerS
= [S186, 199, =
C3
mru1031 FabG1 [S163-167]
200] o
mru1630 = FabG2
o
1-,
mru0955 EgsA [S77, 168, PURINES AND
PYRIMIDINES c7,
,
,

,
VITAMINS AND COFACTORS
mru1839 Pur0 - [S77, 201, mru1560 HemB
[S153, 210- 0
202]
212]t=-4
o
1-.
mru0595 PurP , [S77, 203] mru1541 CobA
[S153, 210- 0.,
.
--.
mru1055 PyrF [S204, 2051
212] o
k..4
mru1853 HemA
[S153, 210- (A
(.4
TRANSCRIPTION .
215]
mru1544 HemD
[S153, 210-
mru1482 RpoE1 [S206, 2071
212, 216]
mru1481 RpoE2 mru0999 HemL
[S210-214]
mru1815 RpoA1 mru1746 HemC
[S153, 211-
mru1814 RpoA2
212]
mru1816 RpoB1 mru0384 AksD
[S217-219]
mru1817 RpoB2 mru1689 AksE
[S217-219]
mru0908 RpoD mru0385 AksA
. [S217, 219, 0
mru0161 RpoF ,
220] 0
. mru1818 RpoH mru1033 AksF
[S217, 219, ' IV
.-.3
mru0913 RpoK
221] .-1
NJ
mru0169 RpoL mru1283 ArfB
[S222] IV
IV
mru0912 RpoN
mru0953 CofC
[S217, 223]
mru1350 RpoP
1.)
mru1253 FtsA1 ,
[S217, 224- c0) .
,_.
mru1787 FtsA2
226] IV
TRANSPORTERS
1
mru0479 F420-
0:gamma-glutamyl ligase [S2171 o
IV
= = mru1842
CofE [S217, 227- 1
mru0405 transporter Na+/H+ antiporter family
r [S208] 229] "
.1,
mru1974 CofG
[5230-232]
UNKNOWN FUNCTION mru1266 CofH
mru2213 FucA
[S233-236]
mru0668 methanogenesis marker protein 1 [S209] mru0672 CofA
[S235]
mru1929 methanogenesis marker protein 10 . mru1844
CofD [S237, 238]
mru0097 methanogenesis marker protein 11 mru1949 ComB
[S239, 240]
mru0181 methanogenesis marker protein 13
1-:
mru1980 ComC
[S82, 217, n
mru1915 . methanogenesis marker protein 14 ,
241, 242] 1-3
mru1771rnru methanogenesis marker protein 15 mru1896 MfnA
[S217, 243]
1778 methanogenesis marker protein 2
mru1690 MptG
[S244-249] N
mru1774 methanogenesis marker protein 3
o
mru1962 MptA
[S250, 251]
mru1931 methanogenesis marker protein 7 ,
1--,
o
inru0436 methanogenesis marker protein 8 mru1559 CitG
[S252-254] C3
o
mru1695 H4MPT-linked Cl transfer pathway protein mru1845 ArfA
[S255, 256] =
1--,
mru1215 RibC
[S257-262] o